Biology question and answers for September 02, 2023
- Q For each E coli genotype and condition in the followingtable, choose which sets of functional proteins will or will not beproduced.All grown in media with no/low glucose.IS indicates a super-repressor...
- Q giving relevant agricultural examples, what are thethree main ways that microorganisms affect our food supply?
- Q Give a 4 sentence summary of this discussion (below) thanks!Title:Development of an Adhesion Assay and Characterization of anAdhesion-Deficient Mutant of Pseudomonas fluorescensDISCUSSION: The reproducibility of the adhesion data obtained inthe...
- Q Please emphasize if the following are cis-acting,trans-acting or both on the lac operon.The lac repressor Protein:The Operator sequence:The Operon sequence:RNA Polymerase II
- Q A bacterial strain called XYZ living in the lake MBG223 nearBilkent University requires to synthesize tryptophancontinuously.  The reason is, the essential proteins(essential means, the proteins required for survival of thebacteria) contain...
- Q 6) How is the lac operon regulated if the bacteria is put into anenvironment where there is excess amount of lactose and glucose atthe same time. (10 pts)7) From the...
- Q Immunoglobulin D:1.Structure and functions2. Evolutionary History3. Unique Structures and components4. roles in aspects of the metabolism of the organism5. how does it interact with other organisms
- Q 5. The Supreme Court has heard a case in which onecompany, Myriad, had the patent rights to two genetic markers, BRCA1 and BRCA 2. What are these markers to and...
- Q The examples we discussed in various case study are familialforms of Alzheimer’s disease. There is also a sporadic form, whicharises in germ line or somatic cells. Which genes do you...
- Q How is the lac operon regulated if the bacteria is putinto an environment where there is excess amount of lactose andglucose at the same time. (10 pts)7) From the previous...
- Q Demonstrate an understanding of the purpose of an outreach programalong with services that could be provided. What are the potentialtypes of outreach programs that could be implemented? How do thevarious...
- Q 1) Discuss the difference between the role of the cuticle in thenematode and the earthworm.2) What is the advantage of segmentation?3) Adaptive radiation has resulted in high morphologicaldiversity amongst the...
- Q CONCLUSIONS: What inputs are required for photosynthesisto produce oxygen and glucose?CONCLUSIONS: A student replicates all the variables ofthe first experiment, except she puts the plant in a sealed jarwithout oxygen...
- Q Genetic analysis has shown that three recessive genes d (dwarf),e (enlarged trunk) and f (fine leaf) are all found on chromosome #1of apple. When a plant that was heterozygous for...
- Q A bacterial strain called XYZ living in the lakeMBG223 requires to synthesize tryptophan continuously. The reasonis, the essential proteins (essential means, the proteins requiredfor survival of the bacteria) contain high...
- Q I have to do an interview with a person who currently has thejob I want. It's not super in-depth and doesn't have to be long.I'm looking for any biologist (preferably...
- Q What sorts of adjustments would P. aeruginosa have to make inadapting successfully to the human lung?
- Q The Krebs Cycle will transform a [substrate] molecule into 3[products]What is the function of NADH and FADH2 in cellularrespiration?When oxygen (O2) accepts electrons in aerobic respiration, it isconverted to _________What...
- Q Which of the statements are true about the cellular processesthat occur during specific phases of the cell cycle in somaticcells? Select all that apply.During S phase, there is synthesis of...
- Q Write an impact statement on water resources and how to solvethe worlds issue with not having enough drinkable water worldwide
- Q What is Western blot used for? Describe how you would perform aWestern blot, starting from the sample preparation step to thefinal analysis.
- Q Answer the following questions in your post:Do you know anyone who has had their DNA analyzed by 23andMe,Ancestry or another company?   How did they feelabout it? explain why you think...
- Q 1. Align human cardiac and skeletal isoforms of humanmyosin-binding protein C. Show alignment. Where these isoformsdiffer most of all from each other?2. Predict secondary structure of the region where isoforms...
- Q ATP is required for both muscle contraction and musclerelaxation. Explain how ATP is used for contraction and how ATP isused for relaxation.
- Q Prior to 1800 in England, the typical moth of the speciesBiston betularia(peppered moth) had a light pattern. Darkcolored moths were rare. By the late 19th century, thelight-colored moths were rare,...
- Q Given this segment of a double-stranded DNA molecule, draw thetwo major steps involved in DNA replication:ATCGGCTAGCTACGGCTATTTACGGCATATTAGCCGATCGATGCCGATAAATGCCGTATA
- Q What are lipoproteins? Describe their structural features andexplain how different classes of lipoproteins are transported inthe body.
- Q What is cellular signal transduction? Explain the generalprinciples and features of signal transduction.
- Q An adult male, 150 pounds, consumes water contaminated with 1milligrams of DDT per liter for three years at a rate of two litersper day. Assuming the man does not receive...
- Q To study genetic variations (i.e. mutations) between species,especially highly divergent species like insects and mammals, whattype of genetic regions or genes have to be used? Give twoexamples​
- Q Briefly describe an infectious disease and how it affects ahuman host.
- Q Discuss the impact of public (government) and privatecontrols on long term care.
- Q Does glucose-6-phosphate allosterically inhibit glucokinase ATALL?
- Q what did yoh learn about GSS
- Q Can you find any mutation, name the domains, if the proteins areconserved, and the amino acid sequences and in which organelle willyou find the genetic material that encodes your genes.>Pseudo-nitzschia...
- Q InDiet and Wellness Ruben Ward Profile 2000 calorie menu fom my plateintake bs goals. Daye of Birth May 7th 1998 19yrs old.
- Q Palapye Biotech Company has 10 scientists in the same lab withyou. One of the co-workers who attended another unnamed Universityin the country got jealous about how technologically advanced youare and...
- Q (i) Describe the phenomenon of functional sequence variationusingantibodies that can bind to a range of different antigens. (ii)Explain the process of domain shuffling inprotein evolution and give an example of...
- Q 1 Discuss three ways in which mutations in genetics can be usedin agriculture2 Can genetics in agriculture be solely responsible for globalfood security?Include reference and citation
- Q Please answer all the questions, won’t take more than 10 minsWhat are the characteristics of living things?How do the isotopes of a single element differ from eachother? Explain with an...
- Q Sketch, photograph, and submit the schemes and submit theschemes of(1) chromosomal non-disjunction in a meiosis and (2)fertilizationthat would lead to the birth of a child with followinggenotypes;indicate all involved genes...
- Q Viruses and bacteria share all the following excep
- Q Please explain if you can:In which of the following is the enzyme properly paired with itsallosteric inhibitor?Multiple answers: You can select more than one optionA- hexokinase: glucose-6-phosphateB- phosphofructokinase: fructose 2...
- Q Explain how living organisms have changed the atmosphere overEarth’s history.
- Q 1. Which of components of the electron transport chain directlymove protons across the inner mitochondrial membrane?2. Consider fermentation.How much ATP is generated during fermentation?How does the amount of ATP generated...
- Q Research in cell biology and metabolism has progressed due tothe discovery of molecules that artificially stimulate or inhibitglucagon/epinephrine and insulin signaling pathways. Let’s say youare working in a lab cataloging...
- Q How do we get from a ligand binding to a heterotrimericGTP-binding protein to the activation of PKA?
- Q Research in cell biology and metabolism has progressed due tothe discovery of molecules that artificially stimulate or inhibitglucagon/epinephrine and insulin signaling pathways. Let’s say youare working in a lab cataloging...
- Q What are some of ways that allow coral reef and antarctic reeffishes to maintain a similar \"pace of life\"?
- Q 24. Put the following events in chronological order (oldest tomost recent):(1) Gorilla and Pan share acommon ancestor.(2) Homo and Pan share acommon ancestor.(3) hominins become bipedal.(4) the onset of the...
- Q Farmers and foresters often inoculate seeds with fungal sporesto promote plant growth and development. Based on what you havelearned about fungi and plant nutrition, explain the rationalesbehind the seed treatment.
- Q What is it about protein enzymes that confers upon them theirspecificity?
- Q A genetic defect in coagulation factor IX causes hemophilia b, adisease characterized by a tendency to bleed profusely after veryminor trauma. However, a genetic defect in coagulation factor XIhas only...
- Q Describe (i) how the process of molecular evolution generatesproteinfamilies, and (ii) how the amino acid sequence alignments basedon sequence similarities for suchmembers of a protein family can be used to...
- Q We talked about HLA genes in autoimmune diseases.However, HLA typing is also important in immunity with respect toorgan and blood matching. Discuss the genetics of HLA typing. Ifgenetic matches are...
- Q Question 1) Microscopy. Give realistic examples for (i) standardlight microscopy, (ii)immunofluorescence microscopy, and (iii) electron microscopy onhow these three distinct forms ofmicroscopy can be used to examine biological questions in...
- Q Kara is a 14-year-old, 125-pound, high schoolbasketball player. She has been feeling fatigued and sore lately,and has been sick three separate times in the last 3–4 months. Karatypically eats the...
- Q Immunoassays can use polyclonal or monoclonal antibodypreparations.a) How do polyclonal antibodies differ from monoclonalantibodies?(Marks: 2)b) Describe one immunoassay that requires the use of polyclonalantibodies.(Marks: 4)c) Describe one immunoassay that requires...
- Q Linda is a half marathon runner. She read an articlein a runner’s magazine promoting a new sports beverage thatcontains protein. She has always used a traditionalcarbohydrate-rich sports beverage, and has...
- Q Describe the principles of diffusion and osmosis across cellmembranes and how organisms maintain an optimal internal fluidenvironment. Can you please talk about:a. the mechanisms by which freshwater paramecia rid their...
- Q Sliding clamps are loaded onto DNA by clamp loaders to serve thecritical role of coordinating various enzymes on DNA. Clamp loadersmust quickly and efficiently load clamps at primer/template (p/t)junctions containing...
- Q Please do not forget to write down all the names of your groupmembers.1. Please propose the mechanism for α−β C-C bond cleavage ofG6P. Draw the mechanism clearly, give the structures...
- Q A ship carrying 2,000 passengers sets sail for an island with apopulation of 23,000. Both of these populations consist of an equalnumber of males and females.21 male passengers on the...
- Q During cellular respiration, what happens to the 6 carbons inglucose?a-All 6 carbons are reduced to CO2.b-All 6 carbons are used in the synthesis of ATP.c-3 carbons are oxidized to CO2...
- Q Consider the ecosytem energy required for various foods in thehuman diet. Describe ways to conserve ecosystem energy byincorporating principles of energy flow between trophic levels.
- Q Bioinformatics:What could be some of the reasons why your query sequence didnot exactly match the sequence in the database (think of sampling,sequencing, and biological reasons).
- Q 4. Discuss mitosis: Name all the stages of mitosis. Describe themain events that happen during each phase.
- Q 5. Explain how cell division is different in prokaryotic andeukaryotic cells. Also, compare the DNA of prokaryotic andeukaryotic cell.
- Q Compare and contrast physical dependence theories of addictionand positive incentive theories of addiction. Which oneexplain addiction better and why?
- Q ELISA Data Sheet1) Please record the sample ID and the color present in each ofthe wells of your test strip (either blue or clear).Well #Sample IDWell ColorTest Result (Positive or...
- Q Compare and contrast cocaine with amphetamine in terms of howit’s consumed, its different uses, the effects it has on the user,and how it manipulates monoamine activity (is the manipulationagonistic or...
- Q In humans, the huntingtin gene is essential for nerve cells tofunction effectively. People with Huntington’s disease have 2different copies of the huntingtin gene – one normal and onemutated. The mutated...
- Q (i) Explain why it is important to assign individuals tospecies. (ii) What is a species concept? (iii) Name and formallydefine one species concept. (iv) Explain ONE of the weaknessesassociated with...
- Q What are viruses composed of? How do they differ from cellularlife? What is their basic life cycle? Describe lytic and lysogeniccycles in bacteriophages. What are three hypotheses about howviruses originated?
- Q How arephylogenies made that extend back 100s of millions ofyears?
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!