1. Which of components of the electron transport chain directly move protons across the inner mitochondrial...

70.2K

Verified Solution

Question

Biology

1. Which of components of the electron transport chain directlymove protons across the inner mitochondrial membrane?

2. Consider fermentation.
How much ATP is generated during fermentation?

How does the amount of ATP generated by fermentation compare toaerobic respiration?


In humans, why can't fermentation sustain life? (Hint: Think of tworeasons—one is related to the product of fermentation and whathappens if it accumulates.)

3. Given this segment of a double-stranded DNA molecule, drawthe two major steps involved in DNA replication:

ATCGGCTAGCTACGGCTATTTACGGCATAT

TAGCCGATCGATGCCGATAAATGCCGTATA

Answer & Explanation Solved by verified expert
4.3 Ratings (747 Votes)
1 electron transport chain is composed of 5 complexComplex I NADH cow dehydrogenaseComplex II succinate dehydrogenaseComplex III cytochrome reductaseComplex IV cytochrome oxidaseComplex V ATP synthaseOut of 5 complex complex IIII and IV are the components whereenough amount of    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students