Biology question and answers for September 28, 2023
- Q The lung airway epithelium regulates the thickness and the pH ofthe airway surface liquid.Describe the airway epithelium and highlight the main molecularmechanism involved in regulating the thickness of the airwaysurface...
- Q In regards to protein function:A) For specific DNA binding proteins,1. what is the structure of a typically DNA binding protein andhow does it interact with DNA?2. why is there a...
- Q If you want to identify genes that change expression levels in amouse model of liver disease under conditions of stress.(i) What kind of DNA library will be the bestone to...
- Q Describe evidence suggesting that inter-individual variation inthe per gene might account for inter-individual variationin the nature of circadian rhythms expressed.
- Q Your friend gives you their special plant food and claims itwill make your plant grow much faster than water alone does.Describe a simple experiment you can do to test the...
- Q How does the 6S RNA promote global changes in geneexpression?Provide examples of how small RNAs can promote RNAdegradation?What is a molecular mechanism by which small RNAspromote translation? Provide an example...
- Q 1. What does the Beer-Lambert Law allow you to do?2. Under what conditions is the Beer-Lambert Law valid?3. Under what conditions is the Beer-Lambert Law not valid?
- Q What barriers have contributed to the establishment of zoographicrealms worldwide?
- Q What are the different types of post-transcriptional regulation ofgene expression? And describe them.
- Q The opening CSF pressure when you performed the lumbar puncturewas 101 mmH2O. The CSF analysis revealed a white bloodcell (WBC) count of 5X106 /L, clear appearance, aprotein level of 0.62...
- Q a. In sequence, name the structures and tissue systems throughwhich a molecule of water passes from the time it is absorbed fromthe soil until it evaporates through a stoma. b....
- Q How are the molecular pathways that control apoptosis and axonalpruning similar and different?
- Q please lost pros and cons of The Genome Project andCelera Genomics.edit: list*
- Q Show all work/formulas used:1) Based on the following data:Genotype: AA Aa aaRelative fitness: Â Â WAA= 1 WAa= 1 Waa= 0.5Number of young: 100 100 8001a) Estimate the frequency of 'aa' young...
- Q describe how a clrician can determine that a patient hasallergies to house mites. ?
- Q Different types of cells have different types of integralmembrane proteins. What would you expect to reside in the plasmamembrane of an epithelial cell that might be absent from that of...
- Q Consider the gene for the character “frecklesâ€. We’ll use “F†todesignate the dominant allele (which produces freckles), and “f†todesignate the recessive allele (no freckles).​​​a.Suppose one parent has freckles. What...
- Q What is the difference between motile and sessile growth ofmicroorganisms?Describe in detail the steps in formation and structure ofbiofilms.Provide one example of a biofilm in nature that is beneficial.Provide one...
- Q what procedure allows us to isolate and extract plasmid DNA andto avoid isolating the larger circulargenomic-chromosomal DNA?Why do many restriction enzymes require a 37 C temperature to beactive and to...
- Q Questions 9-12 concern general information about each of theinvertebrate phyla we discussed this semester. If none of thechoices are appropriate, type ‘not applicable’.9. Phylum Chaetognatha (6)Highest level of organization (cellular,...
- Q Microbial Growth Control- Bacteriology-Briefly describe factors affecting optimal growthtemperatures-Compare & contrast ways in which microbial cells areenumerated.-Describe/define both LD and MIC
- Q what are some ways that micorooganisms are important to theenvironment?Subject lab exercise microbiology ninteenth edition
- Q 2)List the beneficial aspects of Microbes. What is the goal ofthe public health microbiologist when it comes to the microbes?
- Q 5. A kidney-bean shaped eye is produced by a recessive gene, k,on the third chromosome of Drosophila. Orange eye color, calledcardinal, is produced by the recessive gene cd on the...
- Q 1a) If you have three genes H, M, and T located on threedifferent chromosomes and you performed the following cross:HhMmTt x hhmmttHow many phenotypic combinations would you see?1b) If you...
- Q Describe the steps in the electron transport chain includingenzymes and coenzymes involved (4 sentences total)Then, briefly mention 2 other systems of energy production thatmay be used to fuel exercise and...
- Q Using Miller’s hypothesis for adaptive evolution of thrashers(Toxostoma) from a mockingbird (Mimus) ancestor as representing thestandard evolutionary genetic model of the modern synthesis,explain how each of the following hypothesized processes...
- Q A big advantage with the evolution of pollination was:Asexual reproduction could happenSexual reproduction could happen in dry environmentSexual reproduction could happen underwaterSexual reproduction could happen in environments waterIf you compared...
- Q A single strand of DNA, 24 nucleotides long, with thesequence5'-TTTCCCgggAAAgggTTTAAAggg-3'is in a test tube. (Note that G's are shown in lowercase, sothat your eye can better distinguish them from C's)Other...
- Q Which statements describe the structure of lymphaticcapillaries?-Lymphatic capillaries have a layer of smooth muscle in theirwalls.-Collagen filaments anchor the endothelium to loose connectivetissue.-The endothelial cells are not tightly joined together.-Lymphatic...
- Q The Calvin cycle “dark†reactions, which fix CO2, do notfunction in the dark, what are the likely reasons for this. How arethese reactions regulated by light?
- Q A cell is defective in succinate dehydrogenase. Will its HIF-1be hydroxylated by PH-2 under this condition? Justify.
- Q You have three genes on the same chromosome - A, B and C. Eachgene has two alleles in a dominant/recessive relationship. Forthese genes the homozygous recessive has the mutant phenotype...
- Q 1. Describe the compound light microscope, what are thefunction of the stage clips. Specify what type of objects ororganisms you would look at using each of these microscopesrespectively.2. Identify two...
- Q Create a product recipe using yeast as a leavening agent.
- Q ~ALL OF THESE PARTS ARE STRICTLY ASKING ABOUT TheAntibiotic Degrading Enzyme, NOT ANTIBIOTIC RESISTANCE INGENERAL~ the more specific the better; preferably typed, as to belegible; thank you so much in...
- Q 1- Compare and contrast microbial fermentation and aerobicrespiration in sugarbased catabolic systems. Please use diagramsand figures to help explain your answer.2. Outline the three fundamentals of metabolism. In your answergive...
- Q Genetically, how does an organism become antibiotic-resistant?How does the mechanism for resistance spread through a microbialcommunity?
- Q A) How does a polar covalent bond differ from a non-polarcovalent bond?B. ) In a single molecule of water, what is the type of bondbetween the two hydrogen atoms and...
- Q (1) Pre Lab Question: You are working in the lab and are told tocreate an artificial membrane from phospholipids. You are theninstructed to add certain solutes to the membrane to...
- Q Which type of enzyme is routinely used in biotechnology to cutDNA into fragments?Nuclear transplantation (somatic cell nucleartransfer) is a technique that requires multiple steps.Which of the following steps is nota...
- Q Threat to biodiversity in MUTUALISM, COMMENSALISM ANDPARASITISMDescribe the threat. What is it? Where is it? What iscausing it? Etc. (at least a long paragraph descriptionhere).What potential or actual harm can...
- Q Huntington's Disease: The role of the protein targeted by theantisense
- Q Snerp DNA sequence sample Identity: BSnerp DNA sequence: TACCTACGTTCGACT TACACATGCACGATC TACTATGGGTGAATCTACTGAGAGAGCATC TACGAAGCAACGACT TACTCTTTAAGGATC^^^^^^^^^^^^^^^^^^^^^^^^^^^^^6You were given the DNA sequence for the alleles of a total ofsix genes. The genes are separated...
- Q Distinguish between photoreduction and photophosphorylation.
- Q A 34-year-old pregnant female discovered that her husband testedpositive for HIV. She was never screened for HIV infection earlier.She shares this information to her physician during delivery.Immediate screening of the...
- Q How does entropy drive solubility of proteins in water (or not)?Draw me a “system†of a beaker of water with and without 1) Polarsolute and 2) Nonpolar solute. How does...
- Q Define susceptibility, resistance, non-specific resistance, andspecific resistance in regards to immunity
- Q what is the Threat to biodiversity in the Great basindesert?give description, what is it, where, actual herm and 2statistics related to the threat.
- Q Exposure to toxic materials can be hazardous to humans. Whatvariables affect the amount of toxic material an organism will beexposed to? What effect do these variables have?
- Q Researchers conducted a cohort study of the association betweenair pollution and asthma. Therate ratio was 8.0, when comparing those exposed to high levelsof air pollution with thoseexposed to low levels...
- Q Compare and Contrast carbohydrate catabolism and energyproduction in the following bacteria. a. Pseudomonas, an aerobicchemoheterotroph • b. Spirulina, and oxygenic photoautotroph • c.Ectothiorhodospira, an anoxygenic photoautotroph
- Q what strategies are or might be effective to empower clients tomake health decisions? How might these strategies also encourageclients to be accountable for their own health? Provide rationalefor your response.
- Q Microbiology question:Why would quorum sensing be associated with bioluminescence?microbiology
- Q Explain the cellular process about how bile salts and DistilledWater affect the digestion of fats ?
- Q Identify THREE ways that sexual reproduction increases geneticvariability. For each, explain how it increases genetic diversityamong the offspring.
- Q How would the North Atlantic winter habitat be different if theGeat Auk still existed?
- Q Draw a workflow of the original Sanger Sequencing and explainhow the automated Sanger method is more efficient.
- Q 1. Determine if the alleged father can be the real father of thechild. Answer True for Yes and False for No.Mother is type A, child is type A, alleged father...
- Q Glucose Catabolism1) Aerobic cellular respirationGlycolysis, Citric Acid cycle, Electron Transport Chain etc.2) Anaerobic Respiration3) FermentationName the three major pathways for glucose catabolism (on the top^) and briefly describe them (names...
- Q whydoes monoclonal anti-A and monoclonal anti-B eliminate the need foranti-A, B reagent?
- Q Part I: MitosisWhere are the chromosomes during metaphase?What happens to the nuclear envelope during prophase? Whathappens to actual chromosomes in prophase?When do the nucleoli disappear?When do the nucleoli reappear?How is...
- Q Transcription requires _____ to add nucleotides to form an newmolecule.Question 58 options:a)DNA polymeraseb)RNA polymerasec)ribosomesd)tRNAQuestion 59 (2 points)The large ribosomal subunitQuestion 59 options:a)is the first to bind mRNA near the start...
- Q In a Hardy-Weinberg population with two alleles, A and a, thatare in equilibrium, the frequency of allele A is 0.35. What is thepercentage of the population that is homozygous for...
- Q Match each scenario with the type or mode of selection that fitsbest. Answers can be used more than once. Group of answerchoices1.A population of Madagascar hissing cockroaches lives in awoodpile....
- Q Explain the molecular process of digestion of starchwith Amylase?How would ph, water and temperature affectthis
- Q What are the categories that organisms can be grouped in basedon their nutritional requirements. Find one microorganism, either aprokaryote or eukaryote, and describe the environment in which itlives. (Does it...
- Q How might parental care also be costly to a care-giving parent?How do costs vary for males versus females?
- Q 1. (a) How do Chaperones preventaggregation?(b) Is the existence of chaperons, and their necessityin many cases, consistent with the idea that ALL of the foldinginformation for proteins is in the...
- Q Discuss all aspects of the LDL-R pathway – the receptor’sstructure, interactions with the LDLs, the structure of the LDLsand where made, their endocytosis, recycling of receptors, role ofpH – how...
- Q Certain antibody isotypes are more important from blood-borneinfections while other isotypes are more important for food-borneinfections. Taking this into consideration, draw twodifferent immunoglobulin with different effectorfunctions, present in two different...
- Q Water-soluble vitamins participate in all of the followingfunctions exceptGroup of answer choicesblood formation.acting as antioxidants.maintaining the nervous system.lipid metabolism.
- Q BiologyWhat is the correct order (from small to large)?cells, organelles, organ system, community, ecosystemsmolecules, organism, population, communities, biospheremolecules, cells, tissues, ecosystems, communitiesorganelles, cells, population, biosphere, ecosystemscells, organs, population, ecosystems, communitiesAll...
- Q Fruit flies, like all insects, are covered with fine, hair-likebristles, which serve as sensory structures.You discover a male fruit fly, which has short, under-developedbristles.  You cross this male fly with a...
- Q The fact that genes have been �conserved� throughoutevolutionSelect one:a. means that genes that perform certain functions in loweranimals have been maintained even in human DNA.b. enables organisms like yeast to...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!