Biology question and answers for July 26, 2023
- Q Inborn errors of metabolism are disorders resulting from geneticdefects of metabolic genes that regulate energy metabolism.Although rare, there are 2 reported inborn errors of metabolismaffecting the process of gluconeogenesis. The...
- Q In the glycolytic pathway, the enzyme triose phosphate isomerasecatalyzes the conversion of of dihydroxyacetone phosphate toglyceraldehyde-3-phosphate, which is then immediately utilized byglyceraldehyde-3-phosphate hydrogenase to continue throughglycolysis. In an experimental cell...
- Q Following information is from the instruction of Q5 DNApolymerase: One unit of enzyme willincorporate 10 nmol of dNTP into acid insoluble material in 30minutes at 74°C. The temperature of denaturingshould...
- Q 59. If \"O\" is the gene for the color of a carrot, and \"OO\" isthe written form of the genotype, what is the genotype? a. orangeb. heterozygous dominant c. homozygous...
- Q Which of the followingstatements regarding flagella are true?Select one or more:a. Some microbes contain internal flagellab. Some microbes contain external flagellac. All flagella spin in a circular fashiond. Some microbes...
- Q Explain in detail how two-component systems detect anenvironmental signal and mediate a change in transcription inresponse to the signal. Your answer should include all essentialdomains and residues.
- Q A mutation in the liver enzyme PFK-2/FBPase-2 results in theloss of cAMP-dependent kinase phosphorylation site, thus resultingin a loss of responsiveness to cAMP-dependent kinase. What are theeffects of this mutation...
- Q Differences between Translation and transcriptionPurposeDefinition (scientific and in your own words so a 6th graderwould understand it)ProductsLocationInitiationTerminationElongationInhibitions (antibiotics)
- Q Based on Bonnie Bassler’s ted talk “How bacteria talkâ€Why was it useful for scientists to work with bacteria thatgenerated light?How might understanding bacteria better result in newmedications to combat bacteria?
- Q Under what conditions are generalization favoredoverspecialization and vice versa. Explain why those conditionslead to specialization or generalization. For each of the animalsbelow, tell me the ways they are likely to...
- Q Link the genetic characteristics to the DNA structure and alsolist and describe Mendel's principles and describe how eachcontribute to genetic variability. How might biology have bedifferent if his discoveries had...
- Q 8. A circular plasmid of 6200 base pairs (bp) with threerestriction enzyme sites at 900, 1300, and 4000 bp. You digest thisplasmid, then run the digest on a gel. What...
- Q Assuming independent assortment of each gene, in the crossfemale mouse: Aa Bb cc Dd ee FF x male mouse: Aa bb Cc Dd ee fY.Assume all of these genes have...
- Q can any one give me a good explanation for this two questionsplease?How do long chain fatty acyl-CoA molecules regulate acetyl CoAcarboxylase? please Explain also why this regulation makessense.
- Q 1.) If two DNA strands were aligned parallel to one another,would you see a lagging strand? Why?2.) Breifly describe how telomeres shorten after DNAreplication.
- Q Q.For most animals, digestion of food occurs:a. in the cytoplasm of intestinal mucosal cells. b. in the oralcavity.c. in the coelomic body cavity.d. in the lumen of the digestive tract.e....
- Q What are some major differences between making transgenic miceby microinjection and creating knockout mice by homologousrecombination (before the advent of CRISPR/Cas9 technology)?
- Q a. Why does hemoglobin bind so much more readily to a second andthird molecule of oxygen than to the first? b. why is thedeoxyhemoglobin and the oxyhemoglobin so intensely colored?...
- Q what kind of hormones is produced during child's birth
- Q You want to study ribosomes in plant cells and plan to use aprotocol based on ultracentrifugation in cesium chloride (CsCl) inorder to isolate these structures. What do you expect tofind?  ...
- Q Time 11:55 AM.A sixteen-year-old girl is rushed to the emergency room due toextreme fatigue during P.E.Patient History- Since young she has had recurrent episodes of extremefatigue.- Episodes occurred only if...
- Q What geological occurrence did the Permian-Triassic,Triassic-Jurassic and Cretaceous-Tertiary Extinctions have incommon?
- Q Explain the process of how a protein is sequenced from start tofinish. In your answer, clearly identify the role of2-mercaptoethanol, dansyl chloride, phenylisothiocyanate, andtrifluoroacetic acid.
- Q Variations in temperature and pH can cause major changes to aprotein. Explain how.
- Q Insects are by far the most successful lineage of animal. Describethree factors that have contributed to the overall success of theinsects.
- Q Theamniote lineage of vertebrates is better adapted to life on landthan tetrapod lineages that evolved before them. Describe featuresof amniote animals make them so well adapted to life on land.
- Q 1.An example of the pupillary reflex: when shining a light into theleft eye only, the pupils in both the left eye and right eye getsmaller.True or false2. Umami is described...
- Q how amphibians have adapted their morphology and physiology toterrestrial, fossorial, arboreal or freshwater aquatic ecosystems?Provide specific examples from the three extant orders ofamphibians (Anura, Urodela and Gymnophiona). (350 words) noplagiarism
- Q Question 1Not yet answeredMarked out of 1.00Flag questionQuestion textThe function of tRNA is toSelect one:a. provide a site for polypeptide synthesisb. transport amino acids to the ribosomec. transcribe DNAd. transform...
- Q Compare and contrast triglyceride synthesis, fatty acidsynthesis, and phospholipid synthesis
- Q Staphylococcus aureus would have which of the following lab testresults:a) alpha hemolytic, catalase positive, coagulase positiveb) beta hemolytic, catalase positive, coagulase positivec) beta hemolytic catalase negative, coagulase negatived) beta hemolytic...
- Q The disease Leber congenital amaurosis (LCA) caused byloss-of-function mutation of a gene called RPE65, has been treatedwith gene therapy by injecting recombinant AAV vectors containing anormal copy of the RPE65...
- Q Ona trihybrid cross of a tall, purple-flowered pea plant with roundseeds (TtPpRr) with a short, white-flowered pea plant with roundseeds (ttppRr), where you will use the Fork-Line Method todetermine the...
- Q Blue-eyed Mary is a small wildflower whose petals may have oneof three colors: blue, pink, or white. Petal color is determined bythe action of two independently assorting gene loci:
Deposit pigment...
- Q 1.Name the exocrine glands that belong to mucosal immunesystem.2. Give the definition of commensal bacterium.3. In this list, which belongs to peptide’s group?a. Histatin b.Phospholipase A c. Lysozyme L d....
- Q The Red Queen hypothesis is considered to be a specialexample of balancing selection. Which kind of balancing selectionbelow do you think that is?(a) overdominance(b) spatially or temporally variable selection(c) negative...
- Q I have a quiz for the cell structures and their functions.Please answer these questions.1. CHEEK CELLSCheek cells are not the major producers of mucus in the mouth,they do produce a...
- Q Which wavelengths penetrate shallower and deeper layers ofleaves? Why?
- Q Complete the following questions. Illustrates theprocess of DNA transcription, translation, and proteinsynthesis.1.    The stages of transcription areinitiation, elongation, and termination. Draw a representation ofeach of these stages . Be sure to...
- Q The 3 bacteria below each has different virulence factors/mechanisms that allow them to counter the immunesystem. Briefly describe each case.(1) Stahylococcus aureus(2) Listeria monocytogenes(3) Neisseria meningitidis
- Q Cells that accumulate misfolded proteins initiate a stressresponse that includes reducing protein translation by inhibitingthe initiation stage of translation. First explainthe three stages of initiation of protein translation in eukaryoticcells....
- Q How would you prepare adherence cells (tissue culture) in a flowcytometry?
- Q chromosome test
- Q List the various ways that one could test for the presence of apathogen (not the immune response) in a human clinical sample.(Hint: think about the viral genome and central dogma...
- Q How to get cells of plastic dish in staining (flow cytometry)?and how to stain the inside of the cell?
- Q In the E. coli trp operon, what would be the effect ofa deletion in the region 2 sequence, which would prevent it fromforming stable RNA hairpin structure with either regions...
- Q You are working in the ED at Harborview Medical Center. You areseeing a 52-year-old male patient who reports cough, fever,sweating, pleuritic chest pain and general malaise. Yourexamination reveals a fever...
- Q 2.  Which vaccine is a toxoid?a. Influenza (Flu) vaccine.DTap (Diphtheria, Tetanus, Pertussis).Conjugate vaccine (Pneumococcal).BCG vaccine.3.What contributes to the diversity in the Influenza virus?a.Antigenic drift.b.Antigenic shift.c.Segmented RNA.d.All of the above.4. Mutations that...
- Q Using model materials to demonstrate DNAreplication1.    Present a detailed analysis of DNAreplication at one replication fork. Use drawing, descriptions,and/or captions detailing the process.2.    In the analysis include thefollowing:a.    Show how the leading and...
- Q Which of the following are ultimate decomposers?bacteriafungimillipedesCollembolansmitesearthwormsOnly A and B.C, D, E, and F are all reducer decomposers. So are vultures!Which of the following are reducer decomposers?bacteriafungimillipedesCollembolansmitesearthwormsOnly A and B.C,...
- Q write10 to 15 slides with Graphs and diagrams andavoid full slide writing about this topic:1-Genetic effect of radiation-Definition of genetic effects-Difference between genetic and somatic effect-What are these genetic effects-Table...
- Q Which of the following is NOT directly associated withtranslation?A) Elongation of the polypeptideB) Formation of peptide bondsC) Complementary base pairing between codon and anticodonD) mRNA synthesis at the ribosomeE) Transfer...
- Q Describe the parts of the brain neuron including; theaxon ; the dendrite ; what are neurotransmitters? ;what arevesicles? ; describe the Synapse ; what is the function ofreceptors; what is...
- Q describe and explain the teo major countercurrent mechanismspresent in the kidneywhats the major significant feature for each one thatcontributes to its job?how is the countercurrent mechanism utilized for waterconservation?
- Q Explain what is the advantage of the C4 plants(in 250 words)
- Q Discuss the interaction of heredity and theenvironment in producing individual traits and provide a specificexample.
- Q 4.In dancing bears, short fur is dominant to long fur, and curlyhair is dominant to straight. The genes for these traits arelocated on separate autosomes.You have a large population of...
- Q Chymotrypsin activity was measured by the hydrolysis of p-nitrophenylacetate Answer following questions1.1. What are the catalytic triad amino acid residues? 1.2. Inthe reaction mechanism, what amino acid is the residue...
- Q A researcher is interested in elucidating the function of agene found in humans and has chosen a mouse model. Of whatrelevance would comparative genomics,BLAST, and synteny be to theresearcher?2. Spemann...
- Q Describe the life cycle of Rhizopus stolonifer. Include theClass it belongs to and the structures found in their sexual andasexual stages. Name the four (include Fungi imperfecti) classes offungi we...
- Q How would you make E.coli bacteria cells produce humaninsulin for you? More than one answer can becorrecttransform E. coli cells with a gene in which some partswould be from the...
- Q In osmosis, when will there be changes in volume of the twocompartments separated by a selectively permeable membrane?A.When particles in solution are prevented from crossing themembrane (nonpenetrating solutes).B.When the water...
- Q Many rules have been established for laboratories - this includesteaching, clinical, hospital, government laboratories and more. Whydo you think we need such strict rules and policies when it comesto working...
- Q Sea cucumbers (see figure) are classic hydrostats- cylindricalin shape with a body wall surrounding a constant volume of water.Many sea cucumber species crawl along the substrate usingperistaltic locomotion (waves of...
- Q Nervous SystemExplain the mechanism of an action potential in aneuron.
- Q Answer the following questions based on this codingstrand ofDNA:                                                                        5’GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’Drennan et al. (1996) identified several mutations in thisenzyme that result in methylmalonic acidemia (MMA). One of thosemutations is a C...
- Q Imagine if you could tinker with any component of the signaltransduction pathway involved in vision in vertebrates. In thisproblem, you will predict the effect of a change in the activity...
- Q Invertebrates: Mollusc, Annelid, EchinodermFor each invertebrate, answer the following:a. Identify the body symmetry and body cavity.b. Briefly describe its circulatory system.c. What are two specialized characteristics andfeatures?
- Q “Multicellular organisms can only exist due tocell signalling pathwaysâ€. Critically discuss this statementsupporting your arguments with specific and relevant examples.
- Q Upon surveying the material properties of all animals in a coralreef, you find that many materials that organisms use to buildtheir structures are relatively strong, but not necessarily stiff.(a) Describe...
- Q What do we know about Homo floresiensis? How old is it, wheredid it live, what did it look like? And, why is this a considered,by many, to be a controversial...
- Q Climate change and an increasing population present anunprecedented challenge for food security in the coming decades.Propose and justify one or more ways in which we could increase orsafeguard food production.
- Q Excretory (Urinary) SystemHow is urine produced? Include each step of urine productionin the nephron.
- Q You are studying a transcriptional activator proteincalled CYK1, which activates cytokine genes in immune cells and hasboth a nuclear localization and a nuclear export signal and isnormally found both in...
- Q Why do scientists do experiments using PCR? More specifically,what are the temperatures used for PCR and what are the objectivesfor each temperature?
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!