Answer the following questions based on this codingstrand of DNA:                                                                         5’ GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’ Drennan et al. (1996) identified several...

90.2K

Verified Solution

Question

Biology

Answer the following questions based on this codingstrand ofDNA:                                    

                                    5’GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’

Drennan et al. (1996) identified several mutations in thisenzyme that result in methylmalonic acidemia (MMA). One of thosemutations is a C to A at base pair 1904 in the coding strand of DNA(bold and italicized in the template strand).

  1. Write the unique coding strand of DNA for this patient andhighlight the change you made. Write it 5’ to 3’.
  2. Write the mRNA sequence for this patient and clearly highlightthe change you made. Write it 5’ to 3’.
  3. Write the amino acid sequence for this patient, highlight whatdiffers from the normal (wildtype) sequence.
  4. What type of mutation is this? (insertion, deletion, silent,nonsense,missense,or frameshift mutation? Explain yourreasoning.

Answer & Explanation Solved by verified expert
3.6 Ratings (360 Votes)
Answer According to the given question Here we have a coding strand of DNA 5 GGCCATGACAGAGGAGCAAAAGTTATTGCT 3 complementary strand is 3 CCGGTACTGTCTCCTCGTTTTCAATAACGA 5 mRNA 5 GGCCAUGACAGAGGAGCAAAAGUUAUUGCU 3 Amino acid sequenceNterminal Gly His Asp Arg Gly Ala Lys Val Ile Ala C Terminal When there is mutations in DNA coding strand    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students