Answer the following questions based on this codingstrand ofDNA:Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â Â
                                    5’GGCCATGACAGAGGAGCAAAAGTTATTGCT 3’
Drennan et al. (1996) identified several mutations in thisenzyme that result in methylmalonic acidemia (MMA). One of thosemutations is a C to A at base pair 1904 in the coding strand of DNA(bold and italicized in the template strand).
- Write the unique coding strand of DNA for this patient andhighlight the change you made. Write it 5’ to 3’.
- Write the mRNA sequence for this patient and clearly highlightthe change you made. Write it 5’ to 3’.
- Write the amino acid sequence for this patient, highlight whatdiffers from the normal (wildtype) sequence.
- What type of mutation is this? (insertion, deletion, silent,nonsense,missense,or frameshift mutation? Explain yourreasoning.
