Biology question and answers for July 03, 2023
- Q Which of the following processes: T cell development, T cellactivation, B cell development, B cell activation would bedisrupted by a deficiency in the indicated protein. Your answershould include all processes...
- Q 66. You are deciding on a drug treatment for a patient withpancreatic cancer. You know that different drugs have differentefficacies based on the nature of the specific type of tumor....
- Q Ni-NTA resin was used to purify His6-tagged fusion protein Y.What method is used to desorb the fusion protein Y attached to theNi-NTA resin?
- Q What is the function of the rostral migratory stream?A To move newly born cells from the SVZ to the olfactorybulbB To move old, apoptotic cells from the hippocampus to theSVZC...
- Q During neuronal pathfinding, the growth cone of the neuronchemotaxes to the target cell in the brain it needs to reach. Atthat point, the growth cone touches the target cell and...
- Q Describe the structure of AQP1, and explain how aquaporins(AQPs) are able to transport water, while restricting protonhopping.
- Q 2. Imagine that you are conducting an experiment thatcompares the effects of drought on photosynthesis in two species inthe family Ericaceae: Vaccinium parvifolium (redhuckleberry) and Vaccinium oxycoccos (small cranberry),both native...
- Q 3. You are working in a temperate rainforest that hassmall patches of sandy soil spread throughout the area. This soilhas a unique chemistry, different from the soil of the neighboringclay-rich...
- Q Explain why coevolution through Batesian mimicry is most likelyto be stable when the mimic species is rarer than the modelspecies?
- Q No need to explain pleas only answer. thank you_____40. All of the following are considered in classifyingviruses except its                A. nucleic acidcomposition                                B. capsid architecture                C. ability to grow in embryonatedeggs               D. replication strategy_____41....
- Q Presume PSC was favored more than different species concepts,for example BCS. PCS stands for phylogenetic species concept. Whatkind of consequences would there be fora) discourse on speciation evolutionary mechanismsb) species...
- Q 1. You are conducting an experiment to examine geneticvariation and local adaptation in populations of Cypripediummontanum (Mountain Lady’s Slipper, Orchidaceae), which occurat high elevation in open woods in the Northwest...
- Q Imagine that you as a fruit fly researcher cross truebreeding, wild-type flies to true breeding, eyeless flies in the Pgeneration. The resulting F1 generation is made up of 100%wild-type flies...
- Q For a heterozygous individual with the genetic map and genearrangement below:A--------18m.u.---------b-----------20 m.u.------------Ca---------------------------B---------------------------------cWhat percentage of gametes would havethe following genotypes?AbCABCAbc
- Q 1. If you were in charge of distributing one-hundred milliondollars in research funds but could only chose one viral disease toprovide for, which disease would you endow and why?2. How...
- Q Snakes have lost their limbs over the course ofevolution. Recent data show a reduction in Shhexpressionin their limb fields due to loss of a portion of the limb enhancer,noting that...
- Q 22- The hormones FSH and LH are produced by the anteriorpituitary gland.Select one:TrueFalse23- Dr. Ling, the famous brain surgeon, removes a portion of theskull during surgery. Which of the meninges...
- Q Explain how kidney nephrons work to excretenitrogenous wastes and yet retain water, be sure to labeland discuss how the following are involved in this process:Bowman’s capsule (glomerulus), salts, loop of...
- Q How do T cells coordinate the specific humoral immune response.Then describe how T cells coordinate the specific cell mediatedimmune response. For both, be sure to discuss all receptorsinvolved, interleukins, all...
- Q 1. Insects are one of the most abundant and diversegroups of animals with biologists estimating that there are about 5million species with many of them not yet described.Describe three reasons...
- Q What are at least five ways that poxviruses use capturedcellular genes to evade or disable the immune system?
- Q ____________ contractions cause urine to flow into the urinarybladder.
- Q The humongous fungus Armillaria gallica gives rise to honeymushrooms. Like other fungi,Armillaria sprouts tiny threadsunderground; but unlike most fungi, these threads fuse to formshoelace-size strings that extend great distances to...
- Q Discuss in detail the two different types ofoperons found in bacterial genomes (inducible operons andrepressible operons) and describe how they work. Then describe thethree different forms of prokaryotic genetic recombinationdiscussed...
- Q 1. The most dangerous microbial agents have what portal of entryinto the human body? a. respiratory c. parenteralb. urogenital d. fecal2. In addition to digested food, where do carbohydrates comefrom...
- Q Why is the inflammatory response a key factor in theidentification of and defense against an invading microbe. Includein your discussiona. the role of cytokines in an infammatory responseb. what causes...
- Q I just did a \"use of selective and differential media lab\" andone of the questions is \"In what way are the media used in thisinvestigation selective and differential\"? I am...
- Q YOU HAVE DECIDED TO ADD A MASS SPECTROMETER TO YOUR HPLCEQUIPMENT BECAUSE YOU NEED TO SEPARATE AND QUANTIFY SYNTHETICPEPTIDES IN REACTION VESSELS. THE PEPTIDES WILL BE OF FIVE OR FEWERAMINO...
- Q Do you think that any of the specific body plant characteristicscould have evolved based on genes similar to those that created thebox gills in spiders? List the traits Then pick...
- Q Briefly describe the procedure for isolating and testing asuspected E. coli 0157:H7 .
- Q cansomeone give an easy and simple explantion of all the casproteins involved in the steps (adaption, biogenesis,interference) of bacterial immunity by crispr? i know that the cas9protein cuts the DNA,...
- Q Simona is 57 and has been steadily increasing in weight andfeeling tired the last few months. Her additional blood testsreveal high TSH and low FT3 and FT4 levels. Simona is...
- Q Explain with examples the concept of jumping genes inprokaryotes
- Q Previous experiments with the Cdc16 and Cdc23mutants suggested that the encoded proteins work together toexecute common functions. Investigators hypothesized that theyexist in a protein complex. You decided to use yeast...
- Q 14. Describe or draw/label what is inside the fleshy lobe of asarcopterygian fish.15. What single characteristic of the Arthropoda appears toaccount for their success, diversity and abundance?16. How many times...
- Q Compare and contrast protein import into the mitochondria andnucleus. Include the following terms in the way that shows youunderstand differences in the import mechanisms: (1) translocationmechanism, (2) signal sequences (whether...
- Q The condition shown in this family has multiple possible modesof inheritance: X-linked recessive, autosomal dominant, andautosomal recessive. It is always one mode of inheritance for eachfamily (ie it doesn't change...
- Q You have been contacted by the World Health Organization.Because you are a renowned microbiologist, they have asked you tojoin a panel of experts to come up with recommendations to curb...
- Q 6. How does parapatric speciation differ from peripatricspeciation? In which form is genetic drift more likely to beimportant? Why?7. Provide a phylogeny that has four branches and three nodesand that...
- Q Give an account of some major marine biotechnology contributionsto health, agricultural and industrial sectors
- Q Periodic revaccinations are necessary for protection against__________________virus because of constant_____________________________ of surface molecules .Question 69 options:Influenza; antigenic driftHerpes; InversionPolio; bindingPapilloma; LossNone of the above
- Q Please answer all of these to receive full rating!What are the correct description of ELISA?A)Can be used to determine the cell types in a blood sampleB)Can be used to measure...
- Q describe glottal vibratory cycle
- Q 5. If 1/1000 individuals with your genetic background arecarriers for a certain autosomal, recessive disease allele, what isthe chance that both you and your spouse will be carriers?6. (Related to...
- Q In an experiment, cells were growing in a Petri dish that hadbeen coated with Extra-cellular matrix (ECM) components. A peptideadded to the dish caused the cells to detach from the...
- Q A population consists of 100 individuals of the followinggenotypes: 70 AA, 20 Aa, 10 aa. Is this population inHardy-Weinberg equilibrium? Show work.
- Q Let’s say a cell has arrested in the cell cycle due to achromosome being temporarily unable to attach to the microtubulesof the mitotic spindle.(a) At what stage of the cell...
- Q Through Next-Generation Sequencing, we have learned a lot aboutthe human gut microbiome, including community demographics,establishment of the microbiome and microbiome stability. Design astudy to determine the effects of daily kombucha...
- Q You cross a Drosophila female with kidney-shaped and brown eyeswith a male that has wildtype eye shape and color. Kidney-shapedeyes are found in females that are heterozygous for the bar...
- Q Question: The relationship between protein and health iscomplex. Functional protein deficiency states can ... Therelationship between protein and health is complex. Functionalprotein deficiency states can lead to significant diseaseprocesses, and...
- Q Why is the M3 subtype receptor found on smooth muscle fibers ofthe bronchioles? A detailed explanation wold be helpful. thankyou
- Q List the steps for the Acid Fast StainProcedure:List the steps for processing specimens for AFB (sputum,gastric lavage, etc.):
- Q Describe how CAP-cAMP is involved in the metabolism ofmaltose
- Q inthe process of glycolysis, formation of acetyl CoA, krebs cycle andfermentation without oxygen. How is ATP created?
- Q In watermelons, bitter fruit (B) is dominant over sweet fruit(b), and yellow spots (S) are dominant over no spots (s). The genesfor these two characteristics assort independently. A homozygousplant that...
- Q Describe two examples of prokaryotes acting in amulticellular-like manner
- Q What is the advantage of semiconservative replication?
- Q How would changing the type of bread (fresh from abakery, no preservatives vs. prepackaged with preservatives) affectthe results of mold growth ? Describe an experiment that would testyour hypothesis.â€
- Q Discuss how patientprivacy and HIPAA requirements can be maintained.Â
- Q Amixture smear of staph epidermis is and ecoli is gramstained.describe how the smear will stain under the followingconditions. 1)smears stained for 24 hour old culture . 2)smearsstained from 7day old...
- Q DNAstrandmRNAtRNA from Figure 2Amino Acids (number and name)from Figure 3 pg 80CCTGGACCU4GlycineGAAGGTACGTTAGTTGACATGACG
- Q in garden peas, genes controlling height, flower color, and seedsize are on the third autosomegene map:height-----10 mu------- color-------------20mu------ seedsizea purebred tall, red flowered, large-seeded plant is crossedwith a purebred short,...
- Q analysis of 100 patients demonstrated that 52 of them had adisorder and carried a 2kb fragment. Also, 43 of them did not havethe disorder and had a 1.5 kb fragment....
- Q If the chromosome constitution of a diploid individual withfour pairs of chromosomes is specified as AA BB CC DD, what namesare used to describe individuals with the following chromosomeconstitutions:A B...
- Q Full research about the biological human signals (ECG) timedomain and frequency domain analysis (showing all the calculations,diagrams, graphs, wave signals, simulation or a design, Matlabwave, or signal) basically anything related...
- Q 3. A Xhtech company offers two bacterial strains (A and B) forthe commercial production of cellulase that is required in textileindustries.The bacterial strain A secretes the recombinant cellulase and itcosts...
- Q What is catabolite repression how does it allow abacterial cell to use glucose in preference to other sugars
- Q Information for question # 21,22, and 23. Allele frequencies ata wing length locus are measured for a natural population of amigratory cricket species as P(A1) = 0.4 and Q (A2)...
- Q Which of the following statements is TRUE regardingtranscription in most organisms?1. The RNA template strand is used to encode single-strandedRNA2. All genes are transcribed from the same strand of DNA3....
- Q 1. What is codon? (1pt)Â Â Â Â 2. What is an anti-codon? (1pt)Â Â Â Â Â Â Â Â 3. What tRNA bases can be attached tothe mRNA codon, UGC? (1pt)Â Â Â Â Â Â Â Â 4. Where do the amino acids in...
- Q Outline what happens when a pathogen enters a wound or createsan infection (Example: a cold virus enters the respiratory tract orbacteria enter a cut in our skin).  First describe someinnate responses,...
- Q The polymerase that synthesizes which of the following moleculesuses RNA as a template and synthesizes new stands from 5' to3'?1. Neither RNA polymerase nor DNA polymerase2. both RNA polymerase and...
- Q Which one or more of the following are possible parent-childcombinations?Combination. Mothers blood type. fathers Blood type. Baby bloodtype1 o. o. a2. o. b. o3. a a. o4. B. AB. AOnly...
- Q Which of the following occurs in meiosis II but not meiosisI?Select one:A. homologous chromosomes pairB. homologous chromosomes cross-overC. homologous chromatids separateD. all of the aboveE. none of the above
- Q 1. Glyburide, a member of the sulfonylurea family of drugs, isused to treat type 2 diabetes. It binds to and closes the ATP-gatedK+ channels on the pancreatic beta cells. This...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!