Biology question and answers for September 11, 2023
- Q 1. Identify and select any topic of your interestrelated to public health or health informatics, forapproval2. List down your study question, study goal, andstudy specific objectives, for approval3. Why you...
- Q Eastern diamondback rattlesnake venom contains high levles ofPhospholipase A2, this catalyzes the breakdown of the second of thethree (C-2 position) lipid groups of glycerophospholipids. Thoughthe high levels of phospholipase A2...
- Q Several Gulf Coast states most notably Florida but also AL andTX have started artificial coral reef programs off oftheir coasts. From your knowledge of the structure of coral reefsand their...
- Q EthologyUsing the content (examples) from Ape Genius and Crain's(Darwin's theory) Chapter 3, identify and explain three elementswhat must have happened to our species to help it survive andthrive.
- Q Aperson can Lower there cholesterol level upon exercisebecause
- Q Make a table listing the four major challenges to plants livingon land. In the second column, list at least one plant adaptationfor each challenge.
- Q Cloning is a major topic of debate. Briefly describe the processof cloning in the lab incorporating facts.How is cloning involved in gene therapy?Give a specific and detailed example of how...
- Q Which of the following macromolecules would yield only one typeof monomer after complete hydrolysis?A. DNAB. GlycogenC. LipoproteinD. RNAE. TriacylglycerolThe answer is B but can someone explain why that is the...
- Q - In what ways might algae benefit other organisms in thewater?- In what ways might algae harm other organisms?- Suppose you are responsible for \"cleaning up\" a lake that ispolluted...
- Q MacConkey agar is selective and differential. Explainwhy they are selective and differential, and what is in the mediathat enables this to occur.What results would you expect from plating the followingmicroorganisms...
- Q How is glycogen synthesis and breakdown a) reciprocallyregulated to prevent the formation fo a futile cycle? and b)hormonally regulated to increase the supply of available ATP duringtimes of stress?
- Q 1. Suzie was curious about how productive college sophomoresattending Penn State Main campus are in working on a math worksheetwhen listening to music. She decided to conduct an experiment. Shepicked...
- Q What is the relationship between a specimen's total body water(TBW) and the habitat it lives in?
- Q What kinds of materials obtained from a crime scene mightcontain DNA? (2 pts)Consider the following DNA molecule5ʹCCTTGGGGCCAATTGGCCGTACCGAATTCGCCGAATTCCGGAATTGGCCTACGGGCTCGGGCCGG3ʹ3ʹGGAACCCCGGTTAACCGGCATGGCTTAAGCGGCTTAAGGCCTTAACCGGATGCCCGAGCCCGGCC5ʹHow many bp is the original fragment?(1 point)The enzyme HaeIII has thefollowing restriction site   ...
- Q What component of the foraging process best explains thedifferences you see between the functional response of the predatoron each of the prey types?
- Q Short AnswerAs we have been learning during the semester all microorganismare unique and may have the ability to increase its pathogenicitydependent on the environment. This week we were introduced tohydrolytic...
- Q Howmight the ecological features of the forest patches impact thedifferences in diversity you have observed?
- Q Please use this paper to answer both the sub section question indetail please. this paper is avialbale online so thier is noplagirismhttp://genesdev.cshlp.org/content/9/7/783.full.pdfQ. It is mentioned that embryos produced by the...
- Q Please use this paper to answer both the sub section question indetail please. this paper is avialbale online so thier is noplagirismhttp://genesdev.cshlp.org/content/9/7/783.full.pdfQ. How did the use of the cactSu and...
- Q Compare and contrast prokaryotic cells and eukaryotic cells. Beable to complete a table: prokaryotes in the first column,eukaryotes in the second column and rows listing differentorganelles or characteristics.
- Q A true breeding red eyed fly with long bristles was crossed to atrue breeding white eyed fly with stubble bristles. All F1 progenyare red eyed with stubble bristles. An F1...
- Q Should human beings be considered a nonnative (invasive species)or a \"keystone species?\" In your explanation please use at leastone example of a nonnative species to and one example of a\"keystone\"...
- Q Question: From the Article Below, writea review of the current status of development of antibiotics.\" I donot have the figures!\"Article: Antibiotic discovery in the twenty-firstcentury: current trends and future perspectivesNew...
- Q After viruses infect cells, the empty virions stay attached tothe infected cells. Hershey and Chase used a blender to separateempty virion particles from the cells. Why was this important? Whatwould...
- Q PLEASE CHECK MY ANSWERS!(1 pt each) If the following generally apply to allprokaryotes, write ‘P’. If they apply specifically to eukaryotes,write ‘Eâ€. If they apply primarily to bacteria, write ‘B’,...
- Q Assume that a cross is made between a heterozygous tall peaplant and a homozygous short pea plant. Fifty offspring areproduced in the following frequency: 30 = tall 20 = short(a)...
- Q Please use this paper to answer both the sub section question indetail please. this paper is avialbale online so thier is noplagirism http://genesdev.cshlp.org/content/9/7/783.full.pdf1. a: What does the presence of the...
- Q Please use this paper to answer both the sub section question indetail please. this paper is avialbale online so thier is noplagirismhttp://genesdev.cshlp.org/content/9/7/783.full.pdfQ. What is cactSu? How was it discovered and...
- Q Using DNase footprinting, show that the sigma subunit ofprokaryotic RNA Pol binds to nucleotides from -35 to -10 in thepromoter region.a. Outline your experiment and draw and label the data....
- Q True or false?True False  In cell membranes, cholesterol decreasesmembrane fluidity below the transition temperature, but increasesmembrane fluidity above the transition temperature.True False  Escherichia coli cells grown at 40°Cwould be expected to have...
- Q \" In a synapse between two neurons, a postsynaptic potential isa graded potential that is the result of a neurotransmitterreleased into the synaptic cleft. \"TrueFalseQUESTION 17Which neuron would stimulate a...
- Q Treatment of mycobacterial infections generally entails a four-to nine-month antibiotic regimen. How is the length of treatmentconnected to the fact that mycobacterial species tend to grow veryslowly?
- Q Doctors have not been able to find a mutation in the rnapolymerase gene. Why is that?
- Q You have probably had theexperience of being screened many times (e.g., cholesterol test,glucose level test, blood pressure measurement). What is moreimportant information from a PATIENT’s point of view (PPV/NPV vs.Sensitivity/Specificity),...
- Q The Sacramento area was founded on the prospect of gold. Golddiscovery in nearby Coloma brought countless people west with hopesof richer days and better choices for their families. Incollaboration with...
- Q 1)Why would you predict that an animal cell, but not a plantcell, might burst when placed in a hypotonic solution?2)If a bowl of fresh strawberries is sprinkled with sugar, a...
- Q 1)Cell walls are rigid and resist expansion, which allows thepressure to build inside a cell when it absorbs water. The forceexerted by pressing water against the cell wall is called...
- Q Trace your way from the electron transport chain to the citricacid cycle. In a few sentences, explain why the citric acid cyclestops when the electron transport chain is completelyinhibited.
- Q Let's begin with an overview of urine formation. What exactly isurine? How can it be used as a diagnostic tool? What does urinefrom a healthy person contain? How can urine...
- Q In the original implementation of PSI-BLAST, the algorithmperformed a multiple sequence alignment and deleted all but onecopy of aligned sequence segments having ≥ 98% identity. In arecent modification, the program...
- Q Assume you are analyzing the cell division process (mitosis andcytokinesis) in two individuals - a 10 year old male human and a 50year old male human. Contrast the purpose of...
- Q Discuss the Neutral Theory and describe how it has contributedto our understanding of evolutionary processes.
- Q 1. what is a saturated vrs unsatured phospholipid and what doesit do2.What is a alpha linkage and a beta linkage and which one wouldyou find in Glycogen, Starch, and Cellulose?3.How...
- Q 1. What are the intracellular junctions in plants and what dothey do?2.What are the intracellular junctions in animals and what dothey do?3.Why does a larger cell have to work harder...
- Q Indetail, what are the main differences and similarities ofpathogenicity islands and bacteriophages? Talk about their role inbacterial pathogenesis.
- Q (a)The total water potential of an algal cell is -1.7MPa andsolute potential within the cell is -2.6 MPa. The algal cell isplaced in a large volume of 0.95 Molar sucrose...
- Q Microbiology Final Assessment PreparationHighlight the important concepts of microbe-human interaction inhealth and in infection and disease.Outline and discuss the body’s immune system: 1st Line ofImmunity, 2nd Line of Immunity and...
- Q explain the role of alpha helix and beta helix intransmembrane
- Q (b) The following data was obtained from a study of an ecosystemin which 10 different species were randomly identified and theirheights measured. As a Research Assistant for Plant EcologyLaboratory, determine:(i)...
- Q Answer questions in regards to Botany;Infer a phylogeny when provided with a simple character matrix.Be prepared to interpret evolutionary relationships based on aphylogeny.How does molecular data inform phylogenetic analysis?Distinguish among...
- Q Describe the function of each of the structures in bold in theprevious question.-cell wall-chloroplasts-chromoplasts-chromatin-cytoskeleton-leucoplasts-nuclear envelope-nucleolus-rough endoplasmic reticulum-smooth endoplasmic reticulum-vacuole-vesicles
- Q 1 (a). Describe one fundamental way in which proteins and DNAresemble one another and one fundamental way in which they differfrom one another.(b). Using the genetic code table provided in...
- Q Diagram and describe the following prokaryotic structures: cellwall, flagella, fimbriae, inclusions, nucleoid (chromosome andplasmids), and pili.Describe examples of how prokaryotes can benefit as well as harmhumans.Distinguish among the following groups...
- Q Distinguish among the following groups of archaea: extremehalophiles, extreme thermophiles, and methanogens.Compare and contrast viruses with cells.
- Q Ina scientific article, in which section would you explain what thegoal of your work is ?
- Q in a 300-word essay describing how you will use your educationto positively impact and make a difference in the community. Theessay should include information that demonstrates your involvementin the community...
- Q Whyare the principles of segregation and independent assortment key tounderstanding inheritance? How do these principles differ from thetheory of blending inheritance?
- Q Answer the question in regards to Botany;Distinguish among the biological, morphological, andphylogenetic species concepts.Distinguish between allopatric and sympatric speciation.Briefly describe the processes of allopolyploidy,autopolyploidy, and recombination speciation.
- Q Sickle-cell anemia is frequently described as affecting onlyAfricans or people of African descent; it’s considered a “racialâ€disease that doesn’t affect other populations. How would youexplain to someone that this View...
- Q Naked mole rats were recently discovered to be able to survive18 minutes of an anoxic (0% oxygen) environment without anydifficulty. In 1976, the naked mole rat hemoglobin was studied andcompared...
- Q 1. Two homozygous strains of white-flowered bluebonnets aremated, the F1 offspring all have white flowers. The F1 plants arecrossed to each other, 126 white-flowered and 33 blue-floweredplants were produced. Which...
- Q Explain how the rate of glucose transport across cell membranescan be altered without a change in the external glucoseconcentration at which V1/2 and Vmax are measured. Explain whatcellular changes can...
- Q Answer the Questions in regards to Botany;How did Darwin’s observations and readings lead him to discoverthe theory of evolution by natural selection?Describe the five conditions of a population in Hardy-Weinbergequilibrium.Describe...
- Q The cell membranes of mammalian red blood cells are permeable tourea. If red blood cells are dropped into a solution of urea thatis identical in osmotic pressure (isosmotic) to the...
- Q Your lab is studying gene expression of the tryptophan operon inthe bacterium E. coli. In order to facilitate this study, you havecloned the Trp-operon, excised the five coding genes (TrpA,...
- Q PLEASE ANSWER ALL PARTS FULLY!How did the Meselson & Stahl’s experiment allow theinvestigators to distinguish between the 3 overall methods of DNAreplication? What approaches were used in investigating theenzymology of...
- Q Describe the chemical composition of each structures below.(Note that the chemical composition for many of the structureslisted is a phospholipid bilayer.)cell wallchromatincytosol-chloroplastschromoplastscytoskeletonGolgi apparatusleucoplastsmitochondrianuclear envelopeplasma membraneperoxisomesribosomesrough endoplasmic reticulumsmooth endoplasmic reticulumtonoplast
- Q what are the 3 known contact dependent secretion systems? indetail, describe them and state their role in bacterialpathogenesis and their evolutionary origins
- Q In 2002, Trask et al. published a study showing that a highfrequency of HIV transmissions in Lusaka, Zambia occurred betweenmarriage partners. Specifically, they studied a cohort of marriedcouples where, at...
- Q Given the warming climate, you are interested in how seedproduction of a certain plant species if affected by temperature.In particular, you are interested in whether seed production showsa plastic response...
- Q Consider a comparison of two cladistic analyses aimed atreconstructing the phylogeny of a particular set of mammalianspecies. One of these studies used Y-chromosome sequences and theother used mtDNA sequences, and...
- Q Describe a scenario where selection occurs on a trait, but thereis no evolutionary change.
- Q Describe an example of where fossils have been used toreconstruct the behavior of extinct animals.
- Q In a population where skin color gene can be determined by 4alleles B(black)=0.412561 o(olive) = 0.312450 y(yellow) = 0.112689w(white) =0.123540. The gene for skin type can be determined by 3alleles...
- Q what would happen to the charge across the cell membrane outsidecell potassium concentrations are greatly increased by KCLinjection into the blood
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!