Biology question and answers for September 01, 2023
- Q What approximate %T (Transmittance) do you think represents thenormal physiological cell volume?
- Q How many sugars ar needed to provide the energy and constructionmaterial fro making a new cell? Make an estimate for the averagerate of sugar uptake for dividing bacterium.
- Q What does it mean to travel down a concentration gradient? Wouldit take longer for a cell to get oxygen to the middle of the cellvia diffusion if it had a...
- Q Please write about these questions like a small paragraphanswering he questions below:Do you think that microbes can have cooperative traits? Why orwhy not?Think about the RNA viruses that evolve as...
- Q SUMMARYThis discussion is prompted by two articles. The first articleentitled “Genetic variation in chromosome Y regulatessusceptibility to influenza A virus infection†by Krementsov et al.introduces the genetic components of human...
- Q If you wanted to inhibit neutrophile accumulation at the site ofan infection, What mechanism(s) that promote neutrophileaccumulation would you target and why?
- Q whywould a protein get translated into the ER rather than the cytosol?
- Q Please illustrate the steps to recombinant cloning of the vectorto express c-Myc-GFP-His6 in mammalian cells with detailed DNAsequences of primers. Please explain why the chosen particularvector was used and why...
- Q For the last several years scientists have fretted over thefuture of bees, and although research has shed much light on thecrisis, there is still debate on the causes and costs...
- Q Sequence 1:5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAGACAGAATTGACATATAGGCGATGCTAGT3'Sequence 2:5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCGGCTAGATATAACAGGTCCTGAATCGCTA3'Design a splint oligomer and write the all-possible content(s)needed for reaction to occur.
- Q 1. What happens if one solute can pass through the membrane, butanother cannot?2. How do semi-permeable membranes and the processes ofdiffusion and osmosis contribute to homeostasis in cells?
- Q What are two possible explanations for why a species has a limiteddistribution (for example saguaro cactus appears in Arizona but notBaja California)?
- Q The question can be answered in a variety of ways. You areencouraged (and in some case required) to use graphs and diagramsas part of your answer, to illustrate your argument...
- Q Arthropods represent the cumulation of evolutionary developmentin the protostomes. identify at least three characteristics thatcontribute to their success. and explain the selective advantage ofeach exmaple.
- Q Consider the following experimental set up in which glucose isdissolved in water:SolutionA                                 SolutionB                            SolutionC100 glucosemolecules              50 glucosemolecules           75 glucose molecules1 Liter ofwater                         1 Liter ofwater                   1 Liter of waterFill in the blanks:1. Solution A is _________________...
- Q 1. Based on the hormones we have discussed in class, create alist of hormones that play a role in the following areas: increasedCHO utilization, increased PRO synthesis, increased lipidbreakdown/FFA utilization.2....
- Q Using Pasteur's experiment as a model, describe the essentialfeatures of good experimental design and identify those features inPasteur's experiment.
- Q The dairy sector is not well developed in Ghana. With yourunderstanding of animal biotechnology, discuss how the sector canbe improved using biotechnology taking into consideration anyissues or concerns that might...
- Q Explain why any functional impairment of PDC, TCA cycle andETC/oxidative phosphorylation can cause lactic acidosis.
- Q 1. Which organism is easier to grow in the laboratory, E.coli, or Neisseriae gonorrhea?2. Describe the growth of E. coli in (on) softagar.
- Q 1. How many oxidation steps take place in glycolysis per glucosemolecule? How many phosphorylation steps per glucose molecule?2. What is the net number of ATP molecules produced per glucosemolecule during...
- Q Devise a restriction analysis method to confirm the desiredrecombinant; use a single most appropriate enzyme. Calculate theexpected sizes of the restriction fragments from each, the vectorand the desired recombinant
- Q an isolated population of cats are observed for their frequencyin an allele for striped and spotted coloring as well as the actuallevel of heterozygosity in each population. Allele frequency forstripes...
- Q Health literacy is a growing problem in the United States. Howdoes health literacy impact the ability to conduct epidemiologicalstudies and to improve health?
- Q 1- A shallow cut into the trunk of a young tree will oftenresult in the death of any branches above that cut. Explain whythis happens2-On many Ontario highways a plant...
- Q *minimum 250 wordsYou might find it amazing that most cells in the human body eachcontain at least one entire copy of your genome!!! That means asingle cell has the genetic...
- Q Substrate modification necessary for proteasomaldegradation:
- Q Complete the following question by providing detailedexplanations with examples.Explain the roles of cell signaling in DNA transcription andprotein synthesis.
- Q list all of the phases and subclasses of the cellcycle. describe all cellular changes that occur during each.
- Q Explain the overall structure of phosphofructokinase 2/ fructosediphosphate 2, noting why the protein interface is important, andthe role of serine 32.
- Q You are expected to prepare a human pedigree detailing theinheritance of a singlegenetic disease or disorder.The pedigree will be created from the following information:â— There are five generations.â— In generation...
- Q list and describe all types of passive transport foundin cells.
- Q fully describe the process of protein synthesisbeginning at DNA
- Q list and describe the 5 functions of proteins found inthe plasma membrane
- Q Do you consider viruses living or not, explain your answer infull.
- Q what are five characteristics that allowed the evolution ofhumans in primates?
- Q identify the genetic material for hereditary information inside thecell
- Q 1) When viewing a mixed culture of bacteria under a microscope,you notice that there is significant diversity in theirarrangements and shapes.Describe the types of bacterial cellarrangements and what determines the...
- Q microbiologyProtozoa are a polyphyletic group .What does that term mean?Whatcommon characteristics do Protozoa have that facilitates informallygrouping them together?There are four pathogenic protozoan groups,based on their method of motility.Briefly describe...
- Q responed to the writting below any comment ?Since these microorganisms contaminate the earth, we need aprotocol to disinfect the spaceship. The microbes that are found onspace ships are the organisms...
- Q BioOne sentence answers would sufficeAll about lipids Be able to list all hydrophobic macromolecules, 6 classes –fatty acids, triglycerides, phospholipids, Glycolipids, steroids,Terpenes, saturated, unsaturated, R groups in phosphoglycerides –serine, ethanolamine,...
- Q 1) Why is codon bias important?2) If you had a bacterial cell in a solution of sodium at 0.5 Moutside the cell and 0.8 M inside the cell and K+...
- Q This year’s flu, which is dominated by H3N2 (an influenza Astrain), has caused severe morbidity and mortality. The virus isusually spread through contact with aerosols and droplets, andintroduced into epithelial...
- Q Define and briefly describe in the space below the processes ofdigital image capture, image enhancement and image analysis inmicroscopy (1 page limit)about General and Confocal Microscopy and ImageAnalysis
- Q How does Aspartic acid mutated to glycine?What are the effects of the mutation to a protein? What would ischange
- Q Select a contrast mode in microscopy. In the space below,describe and illustrate it in detail (hint: phase, dark-field,bright-field) (1 page limit)
- Q Experiment 2Purple, Smooth KernelsPurple, Wrinkled KernelsYellow, Smooth KernelsYellow, Wrinkled KernelsRow 1114115Row 213972Row 317662Row 4101191Row 510893Total61384213QUESTIONS:::PLEASE ANSWER ALL QUESTIONS AS THEY GO TOGETHER.Everytime questions that go together get split up and...
- Q What are two ways by which bacteria can overcome (or avoid) theeffects of antibiotics? (i.e., list 2 things bacteria can do toantibiotics to make them not work)- 4pts
- Q Create an annotated bibliography where you will locate andsummarize 8 scholarly sources related to childdevelopment that will help to prepare for a interview with a childthat'sbetween ages 3 to 10...
- Q Read the article (link is below) and answer the questions thatfollows in a paper format. (Paper has to be 1-page, 11-inch font-single-spaced).https://www.researchgate.net/publication/50596700_A_long_noncoding_RNA_maintains_active_chromatin_to_coordinate_homeotic_gene_expressionPrimary Paper HW assignment guidelinesYour primary paper consists of...
- Q Describe the results/consequences of two of theevents (items) below (6pts):a. Dendritic cells displaying antigen via the class-2pathwayb. B cell displaying antigen via the class-2 pathway.c. Infected cell displaying antigen by...
- Q What is the relationship between gametophyte and sporophyte inmosses? Ferns? Seed plants?
- Q Select a contrast mode in microscopy. In the space below,describe and illustrate it in detail (hint: phase, dark-field,bright-field) (1 page limit)
- Q If there were very high carbon dioxide conditions (95%) withinan environment, what 3 elements of a flowering plant cycle would beaffected by an environment high in carbon dioxide?
- Q Describe how the present-day theory of evolution wasdeveloped?
- Q Mobility-shift assays can inform about protein-nucleic acidinteractions by comparing:a) the lengths of primer extension reactions in agarosegels.b) elution times during affinity column chromatography.c) sedimentation coefficients following gradientcentrifugation.d) the migration of...
- Q explain how CD8, CD4 and B cells work together either in thelymphoid tissue OR at the site of infection.
- Q How would you increase the amount of amylose compared toamylopectin in potato starch? How would you increase the amount ofamylopectin compared to amylose? What is the advantage ofperforming these manipulations?
- Q Northern white-cheeked gibbon is a small tree-dwelling ape inwhich males and females are equally choosy when it comes to matechoice. What would you predict about: 1) their mating system, 2)allocation...
- Q Need a precise rundown of differences between the cell envelopeof a Gram-negative bacterial cell and a Gram-positive bacterialcell, how the cell membranes and cell walls are different betweenthem and important...
- Q 12. What is the primary aim of the scientific method? A. Toformulate a hypothesis B. To introduce new variables into anExperimentC. To include control groups in an experiment D. Tomodify...
- Q 1. What differences do you observe between the fern life-cycle,and the moss lifecycle?2. Describe the fern sporophyte. Does this part of the planthave haploid or diploid cells? What function is...
- Q 2. Protein-DNA bindinga) List the types of interactions that are involved between aprotein that binds DNA non-specifically and DNA.b) List two proteins that bind to DNA non-specifically.c) List the types...
- Q What are some trends or recent advancements inbioterrorism/microbial forensics?
- Q Describe the structure and function of each of the followingorganelles: Nucleus, Endoplasmic reticulum (both rough and smooth),Golgi Apparatus, Lysosomes, Mitochondria, Chloroplasts(Thylakoids), and the components of the endomembrane system (howare the...
- Q 1-what are the molecular markers of peptic ulcers?2- what treatments would you describe to a peptic ulcer’spatient?3- what is the body’s immune responds to prevent and protect apatient agains the...
- Q Do Enzymes in the digestive tract catalyze hydrolysisreactions.
- Q Explain why a control tube with a nonmotile bacterial species isnecessary for reliable determination of bacterial motility by a)the hang drop preparation and b) the motility test agarpreparation.
- Q Name the appendages found on the abdomen of thecrayfish. How can you identify the sex of the specimen by examiningthese appendages? What special use do they have in thefemale?
- Q Draw a diagram in which Nature and Nurture appear at oppositeends of a continuum. Come up with 10 traits that you can place atvarious locations along this continuum. So, you...
- Q Both alcohol and caffeine affect the neurological system.Although alcohol is a controlled substance, caffeine is not.Develop an argument to make caffeine (coffee and other caffeinatedbeverages) a controlled substance.
- Q MicrobiologyMeningitis Case Study #3Patient A: A 73-year-old Guatemalan man namedFrancisco Salazar was brought into the ER by his daughter with achief complaint of a 5-day history of fever, back and...
- Q The genome of herpes-type viruses is linear double-stranded DNA. Acyclovir is an agentantiviral that inhibits DNA replication in cells infected by this virus. It is administered topatients in dephosphorylated form...
- Q What is the key difference between financial statement analysisand operating indicator analysis? How are these types of analysesuseful to healthcare managers and investors? Consider a healthcareorganization with which you are...
- Q 1. What are the k-mers of length k = 21 for this sequence readin FASTQ format?@K000384:75:HM57CBBXX:1:1101:25530:13841:N:0:GTGGCCCTGGCACTGGGCTTCAAGCTGGGCTACCTTCTGTTT+AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ[please be detailed, thanks]
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!