Biology question and answers for July 13, 2023
- Q If a sequence of one strand of DNA is ATTGCTCG, whatis the complementary sequence?
- Q You test two different bacterial strains with the nitratetest. One tube (organism 1) turns red after the addition ofreagents A and B, while organism 2 stays colorless. You wait twominutes...
- Q explain how the Hershey-Chase experiment conclusivelyproved that DNA and not protein was the genetic material?
- Q complete the table below.Type of fatty acidNumber of double bondsSaturatedMonounsaturatedPolyunsaturated  List three food sources each for saturated, monounsaturatedand polyunsaturated fats.Saturated fat:1. .2. .3. .Monounsaturated fat:1. .2. .3. .Saturated fat:1. .2. .3....
- Q hi, trying to understand the proccess of crebs cycle..a. If Isocitrate dehydrogenase is inhibited by axcess ofcitrate, and alpha ketogluterate by axcess of Suc-CoA, what exactlyhappeneds with the already made...
- Q miocene hominoid Evolution - 1) is it reasonable to expect thatmutation rates are relatively constant over long periods of time?what events would significantly alter the mutation rates of aspecies?
- Q 1. Because plant and animal life on earth is impossible withoutphotosynthesisA. environmental pollution is not a problemB. there is concern for increasing numbers of plant species thatface extinctionC. worldwide decline...
- Q How specifically is the spinal cord, CNS, and PNS involved inthe process of learning a new language? What function do theparasympathetic, sympathetic, autonomic, and somatic nervoussystems have in learning a...
- Q Asa macronutrient, proteins are unique in that they contain whichatom ? ____________There are 20 common amino acids. How many of these areessential amino acids? ______________________Amino acids are joined together by...
- Q Which of the following sequences indicates the presence of arho-independent (intrinsic) transcriptional terminator?A. TGATTTTTTTCGCATTTTAACGAAACGCGCTGCAAAAAAAATTATAB. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCAAAAAAATTATAC. TGAAAAACATCGCATTTTAACGAAACGCGCTGCATTTATTTTTTTTD. TGAAAAACGACAAGCAGCGCGAAACGCGCTGCATTTATTTTTTTT
- Q Compare the following (with definitions and phylogenetic trees):monophyletic, paraphyletic, and polyphyletic taxonomic groups.
- Q 1. How do osmotic power plants work?2 Research the structures that protect plant and animal cellsfrom damage resulting from osmotic pressure. Write a few paragraphsexplaining what they are, how they...
- Q When we consume carbohydrate, it gets digested and absorbed asglucose. It is then stored in the liver and muscle as_______________________. When we consume insufficient energy, ourbody draws on stored glycogen...
- Q Birds migrate from areas of low or decreasing resources to thosewith high or increasing resources of food and nesting locations.Long distance migratory birds would travel in the mostenergy-efficient way and...
- Q Homo erectus -- One Species or Multiple Species?: Somehypothesize that Homo erectus should be subdivided into multiplespecies, others support a single species hypothesis with a broadgeographic distribution and population variation....
- Q You are a bacterium living well in a community of otherbacteria, phage and yeasts. Resources are partitioned well;cooperation is efficient and abundant. But what is this? Onehundred outside bacteria are...
- Q QUESTION 18Briefly describe why E. coli wants toexpress different amounts of the lac operon genes in relation tothe presence/absence of glucose and lactose and themolecular mechanism by which it does...
- Q 1. we discussed the variation among several species of(based on the geological dates we have covered) recent humanspecies that do NOT include neanderthals. I would like for you toidentify two,...
- Q yousampled 550 college students and found that 352 have Darwinstubercle. a) what are the frequencies of alleles T and t? b) whatare the genotype frequencies (TT, Tt and tt) ?...
- Q 1. for 1 molecule of glucose (6 C-atoms), the stage of pyruvateprocessing generatesNADH, CO2 and Acetyl CoAATP, H+, oxaloacetate2NADH, 2CO2 and 2Acetyl CoA2ATP, 2H+, 2 oxaloacetate2. how many reduced electron...
- Q Briefly describe the advantages of the presence of EACHmammalian organ system:The digestive system, circulatory, respiratory,immune/lymphatic, excretory, endocrine, reproductive, nervous,integumentary, skeletal, and muscular
- Q If an adrenergic receptor is a GCPR. Which technique below wouldbest one to confirm that? Hydropathy plot, FRAP analysis, or siRNAknock-down
- Q Acyl-CoA dehydrogenase deficiencies are diseases related to theimpaired ability to oxidize fatty acids via beta oxidation.Symptoms of these acyl-CoA dehydrogenase deficiencies includehypoketosis [low blood levels of ketone bodies], hypoglycemia [lowblood...
- Q Describe the different levels that ecology can bestudied.List and discuss the different abiotic factors thataffect the ecosystem.Describe the process where energy flows through anecosystem, provide examples.What is biomass?
- Q 1. For any one particular type of ligand: Provide your bestthinking about why the the response is stronger when theconcentration of ligand is higher.2.A pair of structurally similar but different...
- Q 40. Titanium, a hapten, is now being usedfrequently in human joint replacement. In terms of an immuneresponse to titanium, you would expect    a.  an innate immuneresponse.    b.  no immune responsebecause...
- Q Compare and contrast the process by which genes are born and theprocess by which genes die. include at least one way in which thesetwo processes are the same, and one...
- Q Acyl-CoA dehydrogenase deficiencies are diseases related to theimpaired ability to oxidize fatty acids via beta oxidation.Symptoms of these acyl-CoA dehydrogenase deficiencies includehypoketosis [low blood levels of ketone bodies], hypoglycemia [lowblood...
- Q Amembrane separates two solutions. Solution C is 300 mL of 0.2 MNaCl, and Solution D is 500 mL of 0.6 M NaCl. The membrane ispermeable to water, sodium ions, and...
- Q Homo erectus -- One Species or MultipleSpecies?:Some hypothesize that Homo erectus should be subdividedinto multiple species, others support a single species hypothesiswith a broad geographic distribution and population variation.There is...
- Q westudied many aspects of pollution on marine mammals including oilspills, PCBs, mercury, and plastics. discuss the specific problems,effects in specific ecosystems, anf any and all processesinvolved.
- Q Please summarize the function of RNA polymerase IIcarboxy-terminal domain (CTD) in RNA processing for proper mRNAfunction
- Q What is a goal of human therapeutic cloning?to transfer cells from an unrelated individual into a patientneeding a transplantto create pluripotent cells for medical research onlyto make a new individual,...
- Q What type of climate is generally found in costal sage scrubareas? How would this affect recovery after disturbance? Pleaseexplain in great detail!
- Q Q1)A) True or False? Proximity and orientation effects are afeature of all enzyme-catalyzed reactions. Explain yourreasoning.B) PMSF (phenylmethylsulfonyl fluoride) is an inactivator ofserine proteases. It is commonly used in the...
- Q 1. If viruses were to be c;classified in manner similar to theclassification of organisms, the broadest classification currentlyused for all viruses is the...A) PhylumB) GenusC) ClassD) family2. Which of the...
- Q Escherichia coliPseudomonas malliBacillus megateriumBacillusanthracis,Lactobacillusacidophilus,Pseudomonas aeruginosa,Serratia marcescensStaphylococcus capraeStreptococcus mutansNeisseria gonorrhoeae,Staphylococcus aureus,Streptococcus pyogenes,Proteus myxofaciens,Klebsiella pneumoniae sub sp pneumoniaeSalmonella bongroriShigella sonneiCorynebacterium xerosisEnterobacter aerogenesProteus vulgarisEscherichia vulnerisEscherichia blattaeSalmonella choleraesuis (subsp. diarizonae)Enterobacter hormaecheiEnterobacter asburiaeCitrobacter diversusCitrobacter freudiiIn...
- Q Know the order of the digestive tract from the mouth to theanus:What organ does the pancreas deliver enzymes to:The function of hydrochloric acid in the digestive system isWhat are the...
- Q 62. A population of a grasshopper species inthe Kansas prairie has two color phenotypes, with 90% of thegrasshoppers green and 10% brown. Typically in the last century,the prairie receives adequate...
- Q How is fertilization in conifers different than fertilizationin angiosperms?Draw and label the steps in Angiosperm doublefertilization.
- Q Describe three (3) specific ways human sexual reproductionproduces genetic diversity in offspring.Consider this hypothetical situation: you are heterozygous foran autosomal recessive genetic disorder and your potentialreproductive partner is also heterozygous...
- Q When gluconeogenesis is activated during fasting in liver,glycolysis slows. How does this happen?a. pyruvate kinase and pyruvate dehydrogenase are both inhibitedby phosphorylation in response to a decreased insulin/glucagonratiob. PFK-2 is...
- Q SummaryAn enzyme-linked immunosorbent assay (ELISA) is typicallyperformed to detect the presence and/or amount of a target proteinof interest within an experimental sample. Detection of the targetprotein is made possible by...
- Q Choose correct answers: Which of the following are true ofinsulin receptors?Question 5 options:Afound on muscle cellsBfound predominately on beta cellsCbind insulin and change shapeDallow insulin to enter the cellEEnzyme linked...
- Q Mention two equations for determination of GFR value.
- Q 59. Your biology class is performing an osmosisexperiment. You are given three identical stalks of celery andthree salt solutions of varying concentrations, describedbelow.Salt Amount of the Solution      Solution A has more...
- Q Write a essay on obesity disease?
- Q 1. Draw and label (or generate in excel) the standard growthcurve for bacteria. Explain each of the stages of this curve fully.Conclude by explaining how and why this curve might...
- Q 1. The novel corona virus that causes Covid 19 has givenscientists and especially virologists a great new challenge.Describe the biology of this virus in detail. Then go on to explainfully...
- Q 1. Describe and/or draw in detail the gram positive and the gramnegative bacterial envelope. Then go on to describe all the stepsof a gram stain. Conclude by explaining why the...
- Q As the scientific director of a pharmaceutical company, you areinterested in developing a drug that would prevent the cataplecticattacks experienced by narcoleptic humans. Based on the series ofscientific research articles...
- Q During a bioremediation process, nitrates and phosphates areadded to soil contaminated with petroleum oil. Explain whychemicals such as nitrates and phosphates are added to the soilinstead of adding additional bacteria.
- Q Evaluate the statements below, and select those that correctlyapply to the process of high throughput genome sequencing. CheckAll That Apply In the 4th step, the sequenced fragments arealigned, and the...
- Q What are the three mechanisms of horizontal gene transfer?Describe each of the three in detail. Then go on to describe theimplications of horizontal gene transfer to microbial evolution and2. human...
- Q 7. Individual C has a mutation in the proopiomelanocortin gene(POMC), resulting in the lack of functional alpha-melanocytestimulating hormone (alpha-MSH).a) How might this mutation impact binding at the MC4receptor?b) Phenotypically, is...
- Q 1-explaine the role of personal and community nutrition in healthpromotion2-outline the steps in the digestion, absorption, andtransport fats.3-describe how an excess of carbohydrate, protien and fat cancontribute to body fat...
- Q Would treating human ES cells with increasing concentrations ofNGF lead to increasing differentiating of neuronal cells.can you help me with some background information
- Q Describe the steps in the process of transcription of DNA toRNA.
- Q What is the numbering scheme for naming fatty acids and what isthe difference between cis and trans fatty acids?What are the general properities of glycosidic linkages?
- Q Using one example from each of the eye and the kidney, comparehow the organ ensures an optimum physiological response.
- Q In detail, describe and/or illustrate each of the chemicalprocesses whereby genetic information is transferred from nucleargenes in a eukaryotic cell to the final usable protein.
- Q Write 1-2 paragraphs-long plan for starting viable business incoronavirus/post-coronavirus world. Tie up your plan to the skillsyou have learned in R&D in Biotech company class ïŠ Thisquestion will have differential...
- Q Describe the “Modern Synthesis†of the theory of evolution.Include all aspects of Darwin’s original theory and the ways inwhich it has been improved/added to with new discoveries since histime.
- Q *college level answer or below. minimum 250 wordsBryophytes were once the dominant land plants, then seedlessvascular plants took over. Gymnosperms came after that but werereplaced by Angiosperms. Discuss the adaptations...
- Q How do CAM plants avoid oxygenation and photorespiration? How doC4 plants avoid oxygenation and photorespiration?
- Q 18. Short hair in rabbits is governed by a dominant gene (L) andlong hair by a recessive allele (l). Black hair results form theaction of the dominant genotype (B_) and...
- Q Which is a product of the light dependent reactions but NOT areactant of the Calvin Cycle of photosynthesis?carbon dioxideNADPHATPoxygen
- Q Describe the major innovations, from earliest (most ancient) tomost recent, that made plants progressively more able to cope withdry conditions on land. Include the 4 major groups of landplants
- Q Design an experiment that tests the effect of body temperatureon the aerobic capacity in an animal of your choice. What variableswould you measure, and how? Include detail about experimentaldesign and...
- Q 3)What are “age structured†population models and how do they informtoxicological impacts on populations? Why are such models betterindicators of toxicant effects compared to the theoretical modelsof exponential and logistic...
- Q Please give a detailed response and describe how T cellscoordinate the specific humoral immune response. Then describe howT cells coordinate the specific cell mediated immune response. Forboth, be sure to...
- Q Cell Biology Question:How does defective DNA repair have an effect on cancer cellproliferation? (explain please)
- Q Many environmental toxicologists feel that animal testing todetermine the safety of industrial and pharmaceutical chemicals forhuman and environment health will diminish in future. What methodsor new approaches will take the...
- Q You’re provided a lab protocol to perform a very shortdigestion of eukaryotic chromatin with micrococcal nuclease, whichshould result in DNA fragments of 200 base pairs. You setup theexperiment but get...
- Q Inthe Community Tolerance Test, the tolerance of representativespecies in a community exposed to a toxicant is compared to thetolerance of species in a reference, non-exposed community. Why orhow is tolerance...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!