Biology question and answers for September 26, 2023
- Q PCR reactions are specific to particular pieces ofDNA. Which component of the reaction allows for this specificity?Explain how.Sanger Sequencing (also called chain termination anddideoxy-sequencing) utilizes special dideoxy nucleotides (ddNTPs).What is...
- Q Neither Tsar Nicholas II nor his wife Empress Alexandra had thedisease known as hemophilia, characterized by being linked to sex.Her daughter, the princess Anastasia didn't have it either, butZarevich Alexius,...
- Q Using your knowledge of DNA replication, copy the following.Write down all the important steps and players of the reaction.Show the primer location and derive the complimentary strandsequence.5` - AGATTCTGAGTCGTGACTCGTACGTCATAACTT -3`
- Q You just isolated a new strain of mutant mice, and preliminarymating suggest that the new mutant phenotype is not inherited in anautosomal fashion. Circumstantial evidence seems to indicate thatthe mutant...
- Q Testing the goodness of fit between the data and theHardy Weinberg equilibrium model generatedexpectations.4.1 In a species of bird, feather color is controlled bygenes at a single locus, with the...
- Q although moving onto land had its benefits plants,were facedwith some major challenges if they were to be successful. pleaseexplain two benefits and two challenges they faced and describeadaptations they evolved...
- Q War on CancerThe underlying assumption of most approaches contained withinthe War On Cancer is that we can find one cure for all cancers.Consider just two types of cancer: basal cell...
- Q You have isolated a strain of brewer’s yeast (Saccharomycescerevisiae) in the lab for your second job at a hip newmicrobrew . You find that this strain ferments more efficiently andadds...
- Q 6c) Explain how eukaryotic organelles are able to transportmaterials between one another.6d) Considering your answer from 6c, explain how cells are ableto import and export large and larger amount of...
- Q . For each of the restriction enzymes listed below: (i)Approximately how many restriction fragments would result fromdigestion of the human genome (3 x 109 bases) with the enzyme? (ii)State whether...
- Q (h) Pseudomonas aeruginosa also usesthe Entner-Doudoroff pathway to degrade glucose. Use IMG or BLAST(or MetaCyc) to identify which enzymes in the EMP pathway aremissing from P. aeruginosa PAO1.(i) Biochemical experiments...
- Q In what polysaccharide does a redwood tree store its energy?
- Q Briefly describe the 3 signals involved in the activation anddifferentiation of a naive CD4+ T cell into an effector Th2 (Thelper) cell.
- Q Describe the experimental procedure used to accomplish DNAtransformation into bacterial cells.
- Q Identify which Mill's method is best exemplified. Explain whythe Mill's method is exemplified. Demonstrate your understanding ofthe scientific concept and the logical structure by writing foreach passage why the particular...
- Q What is the difference between transcription and DNAreplication?In what phase of the cell cycle does DNA replicationoccur?What is the difference between Mitosis and cytokenesis?Give the function of the following:DNA polymetaseHelicasebinding...
- Q Describe how Human SKULL and Pig SKULL are different andsimilar.
- Q Iunderstand that active transport is required to make a protongradient, which provides energy to push/drive ATP synthase.Following this information, however, is it active transport orpassive diffusion during ATP synthesis? please...
- Q The phenotypic ratio of the F1 offspring produced bythe cross between the tan body female fly and the wild-type malefly is 50% wild females: 50% tan body males.Whatchromosome did the...
- Q 1. In a Quelling reaction test, the antibodies added to thesputum sample are reacting to what morphological feature on thebacterium which causes the bacterium to swell - a positive testresult.outer...
- Q Health concerns for food revoloutions. And how can I solve thishealth concern problem?
- Q On chocolate agar, colonies are small raised, glistening, andgray-white. The bacterial cells are gram-negative and spherical,tending to occur in pairs with adjacent sides flattened. In gramstain preparations made from smears...
- Q For which of the following medical conditions is the interactionof genes and environment likely to be important in themanifestation of the phenotype? A) alcoholism B) type 2 diabetes C)obesity D)...
- Q 8. One way to go green in the city of New York would be to eatlocally grown organic foods. Why would eating local and organicfoods be Earth friendly? Please note...
- Q describe on detail the procesa of translation. please remeber tolist the key players (proteins, molecules and emzymes)
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!