Biology question and answers for August 09, 2023
- Q Which DNA replication model is the correct model? Why?Suppose that you have a chemical substance, how do you test ifthis substance is a mutagen?question 2 most important
- Q It is now common to find MRSA and other resistant microbes inthe hospital. How would these likely appear on a Kirby-Bauerplate?a. There would be sensitivityb. There would be no zonesc....
- Q 1. While sitting, a patient experienced a heart rate of 110beats/minute, hypertension, and pupil dilation. His diet habits hadnot change and he did not gain or lose weight. Lab results...
- Q 1.The following is the major hormone secreted from the adrenalmedulla:a) Norepinephrineb) Epinephrinec) Acetylcholined) Aldosteronee) All of the Above2. Excessive secretion of the following leads totachycardia:a) Norepinephrineb) Epinephrinec) Aldosteroned) Cortisole) A...
- Q 8) Suppose you examine a second sample of fruit flies producedfive reproductive cycles (five generations) later.a. How would the allele frequencies for eye colour compare tothose from your original sample?...
- Q Isit possible for a given human to have 5 alleles in thepopulation?
- Q Recent advances in molecular techniques have allowed scientiststo successfully extract proteins and DNA fragments from extinctanimals found in museum collections or the recent fossil record. Inthe near future, it may...
- Q Five social impact of the COVID19 crisis towards society. Writemore than 800 words
- Q Which statement is false regarding DNA/RNA isolation?a) Remove protein: proteinase K, pronase, phenol/CHCl3b) Concentrate with EtOH + saltc) DNA: DNAase denatured by heat (650C), EDTAd) RNA: RNAase – very unstable,...
- Q 1.The RDA for protein is 0.8 grams/kg of body weight. What wouldbe the recommended amount of protein for a 170 pound male who is 5feet, 10 inches tall?  Remember: kg body...
- Q Explain the structural unit of the eukaryoticnucleosome, including DNA and protein components. In addition,describe how the nucleosome is assembled. Be specific regarding thenumber and type of the subunits and how...
- Q 1.Cholesterol is:essential for good health, but cannont be made by the body insufficient amountsfound in foods of plant originprecursor of vitamin Cfound only in foods of animal origin2.Hydrogenation is a...
- Q 1.Type of fiber that slows gastric emptying andlowers blood glucose.PolysassacharideSolubleHDLInsoluble2.What is meant by Amino Acid Sequence?Number of side chains in the proteinFolding arrangement of the peptide chainOrder of amino acids...
- Q Explain cellular respiration as if you were talking to a 5thgrader - that means that you need to define ALL biology vocabularythat you use. Be creative in your explanation, WHICH...
- Q 11. The lacZ gene, responsible for lactose metabolism is aninducible gene regulated by a repressor protein. Answer thefollowing questions regarding how this gene is regulated (3 ptseach) a. What is...
- Q Describe how photosynthesis might play a direct role in theswitch to flowering
- Q CF is an autosomal recessive condition. A population of 387individuals has 7 people with CF. If we assume that the CF gene isin Hardy-Weinberg equilibriumwhat is the estimated frequency of...
- Q Genetic Disorder: Argininosuccinic Aciduria (use forbottom section)Mode of Inheritance: By an autosomal recessivetraitScenario 1Both parents are afflicted with the geneticdisorder.Parent Genotypes:Parent Phenotypes:Punnett Square showing the possibleoffspring:Â Â Â Possible Offspring Genotypes:Possible Offspring Phenotypes:Probability...
- Q Which is not true for Type II photosensitization pathway?Select one:a. requires a donor moleculeb. involves transfer of excited spin-state energy fromsensitizer to another moleculec. does not need initial excitation of...
- Q 1. Photosynthetic organisms have mechanisms to protect thephotosynthetic light reaction from environmental stresses. Take oneor two examples for this, and explain the mechanism briefly.2. Summarize how reactive oxygen species are...
- Q Imagine you are a conservation manager in New York City, tryingto protect an endangered squirrel. How would you design a reservesystem that would help the squirrel, but also work in...
- Q Wildlife Species Description and Significance for Columbia BasinPygmy Rabbit?
- Q A plant cell develops a mutation in its Rubisco gene thatresults in no production of the enzyme.What would be the effect on the light reactions, onphotosynthesis and on the organism...
- Q Assume that the gene trpA in an auxotrophic strain ofE. coli is located at 27 minutes, whereas the genepyrE is located at 81 minutes.Present an experimental scheme that would allow...
- Q The type of gene editing depicted in the movie Gattaca remainsfictional, but we are closer and closer to that reality. Supposethis becomes a reality - how do you think that...
- Q Imagine that the donut is a sexually reproducing animal and thata single enzyme forms the hole. All donuts observed in the pasthave had holes. Suppose a mutation occurs in one...
- Q Propionibacterium is part of the normal microbiota of theskin. T or FCandidiasisoften occurs following antibiotic therapy for fungalinfections.   T orFThe symptoms of tetanusare due to   tetanospasmin.T orFInitialtreatment for tetanus in...
- Q Oleate is a C fatty acid with one double bond between the andcarbons. The ? oxidation of a saturated fatty acid with anequivalent number of carbons would yield ATP: cycles...
- Q Graft-Versus-Host disease will most likely be acomplication of a blood transfusion. T orFDesensitizationto prevent allergies involves the injection of increasingamounts of IgE.T orF.Hemolytic disease of the newborn can result from...
- Q 1. Sketch the elements of the trp operon, including theleader sequence.TryptophanRepressor statusBound to trp or unbound?Operator statusBound or open?Attenuator status(which regions 1-2, 2-3, 3-4 are basepaired, if any? Is it...
- Q What activities of a eukaryotic cell would be affected bydysfunctional histone proteins that can’t properly condense the DNAinto nucleosomes?How would these activities be affected?
- Q Please answer these questions in as long of detail aspossible.Question 1a) Write the expression used to calculate rateof digestion as it’s related to starch concentration and time:b) Explain what a...
- Q Assume COD entering an anaerobic digester can be modeled as2C3H5O3- = C3H5O2- + C2H3O2- + CO2 + H2 (Balanced reactionNext, assume that methane in the reactor results from twopathways: aceticlastic...
- Q examples of biological N fixation that occur in the PacificNorthwest region. Please address these questions:• What is biological nitrogen fixation?• Why is the fixation process important?• What is symbiosis? Who...
- Q Does the following fitness array reflect heterozygoteinferiority or superiority?          A1A1              A1A2                  A2A2fitness0.70                1                    0.80Calculate the equilibrium frequency of p for the givenfitnesses.Is this a stable or unstable equilibrium?
- Q Leopold was clearly offering an alternative definition of, andorientation for, conservation. Though it sounds simplistic, forLeopold, conservation required the establishment of a state ofharmony between humans and nature, which implied...
- Q 1. When a cell is respiring, carbon dioxide is in ________concentration inside the cell, causing it to diffuse out, whereas________ is in high concentration outside the cell, causing it todiffuse...
- Q The Scenario: Your friend Bob asks you to sign a Change.orgpetition to encourage your Congressman to propose a bill that wouldoutlaw all stem cell research and treatments. The reason given...
- Q ina study of a population of field mice, you find that 49% of themice have a coat color that indicates that they are homozygousrecessive. what would be the frequency of...
- Q In the early 1700's Edward Jenner demonstrated and was creditedwith the concept of vaccination. the theory/mechanism surroundinghow the immunity to smallpox was achieved is referred to as \"crossreactivity. Explain why...
- Q Discuss the flow of electrons in the non-cyclic pathway.
- Q 3. Describe what it means for an organism to be triploblastic.What structures of the internal anatomy of a clam might lead you toconclude that a clam is triploblastic?
- Q Create a table that shows the relationships between monomers,polymers, and types of bonds, for sugars, proteins, nucleic acids,and lipids.Write two well-composed, logical sentences for each of the fourmolecules above. Write...
- Q How does the presence of a nuclear envelope affect geneexpression in eukaryotes? But i need all the details about thequestion so please explain it in details thank you so much<3
- Q An individual that is heterozygous for two independent traitshas the potential to produce gametes with more combinations ofgenotypes for those two traits than an individual that is onlyheterozygous for one...
- Q Whyare electrons important
- Q Define economic adulteration and esthetic adulteration?Describe an example food of each type.
- Q Youare trying to control the growth of Listeria monocytogenes infoods, using “multiple hurdle techniques†.Why do you need to use multiple hurdle techniques to controlthis bacterium?What would be your etched...
- Q Illustrate and label the interactions between its hypotheticalmodel of a substrate molecule bound in the active site of anenzyme.
- Q Mitochondria and chloroplasts are two types of organelles ineukaryotic cells. Current studies suggest that both organelles mayhave evolved by endosymbiosis of prokaryotes. Describe thefunctions of these two organelles and propose...
- Q Two old science fiction movies, Godzilla (1998) and Aliens(1986) depict fictional large female carnivores.  TheGodzilla female lives off a large prey population of humans andfishes but has no assistance from others...
- Q Briefly outline the processes of mitochondrial fission andfusion; and how dysregulation or disruption of these mechanisms cancontribute to disease
- Q Sponges live by creating a current of water that entersthe body through the ostia and circulates through their canals andchambers. What vital activities essential for the survival of thesponge are...
- Q Adjustment in high altitude includes ____________.an increase in minute respiratory volumehypersecretion of erythropoietindyspneaan increase in hemoglobin saturationA and D
- Q Is Alzheimer's disease a chronic disease? Explain
- Q The promoter region in bacteria is called the -35 and -10region.True or False
- Q 1. Which checkpoint and phase of the cell cycle is theexpression of BRCA1 and BRCA2 the greatest? What is the function ofBRCA1 and why would it make sense that its...
- Q Why do phospholipids form a bilayer in water-basedsolutions?
- Q 1. How is evolution important to current/furture medicalpractive (for practitioner and patient, with examples)2. Describe how evolutionary theory allows for a betterknowledge about human behavior and how does this impact...
- Q The following sequence of 30 nucleotides corresponds to one ofthe two strands of a double stranded DNA:5’ GATGTGATCAGACCGGGTGCACTCTAATCT 3’a) This sequence has two perfect palindromes that consist of 6base pairs...
- Q The health of an organism depends on a process that controls thebalance of water uptake and loss. This process is called:Answer:Enzymes speed up chemical reactions. The scientific term for“speed upâ€...
- Q Match each term with its definition.The organelle responsible for energy production in both animaland plant cellsThe structure found in plant cells but not animal cellsA substance composed of proteins secreted...
- Q Elaborate on the basic principles of light microscopy and theelectron microscopy as to how they work to magnify specimen.
- Q Elaborate on the type of stains used for the following:EndosporesFlagellaCapsuleWhite blood cells
- Q How does size exclusion column work and what are the ratelimiting factors in purification method?
- Q Please discuss about Corona virus what and what is the impact ofthis word on American culture? What about other cultures? Why isthe history of corona virus important for us to...
- Q Please read the two scnarious and answer the questions:Scenario #1Ten pea plant seeds were planted in each of 5 pots that contained500g of “Peat’s Potting Soil.†The pots were given...
- Q 1.If approximately one in every 2500 white individuals in theunited states is affected by the autosomal recessive disease cysticfibrosis, what are the frequencies of both the dominant andrecessive alleles in...
- Q What is the difference between SDS-PAGE gel and Native geland what do you use to visualize migrated proteins?
- Q Discuss the biological efficiencies gained by organizing proteinfunction on a membrane (hint: one critical point is the membraneserving as an interface between environments). Provide an examplefor each.
- Q What is the purpose of publishing in a scientific journal?
- Q Genetic variation is the difference in DNA sequences betweenindividuals within a population. The human genome has about 3 ×109 base pairs of DNA, and between any two humans, theamount of...
- Q 1. Explain the role of FSH and LH in the reproductive systems ofhumans. What does each hormone do, and what parts of thereproductive tract are affected?2. Why is the action...
- Q Question 3.Human haemoglobin is a complex protein molecule made up of fourpoly-peptides joined to an iron-containing haem group. In normalhuman adult haemoglobin, haemoglobin A, or HbA, two kinds ofpolypeptides designated...
- Q Describe the process of gene regulation using the diphtheriatoxin gene. More correct, relevant detail is better.
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!