The following sequence of 30 nucleotides corresponds to one of the two strands of a double...

80.2K

Verified Solution

Question

Biology

The following sequence of 30 nucleotides corresponds to one ofthe two strands of a double stranded DNA:
5â€™ GATGTGATCAGACCGGGTGCACTCTAATCT 3â€™
a) This sequence has two perfect palindromes that consist of 6base pairs each. What is the sequence of these two palindromes?
b) Show both strands of your FIRST palindrome (indicate the5â€™-3â€™ polarity)
c) Show both strands of your SECOND palindrome (indicate the5â€™-3â€™ polarity)
Assume that the two palindromes are recognized by â€œ6-cutterâ€restriction enzymes, and that each enzyme creates bluntends. Assuming the 30bp DNA sequence is digested with BOTHenzymes, and that the resulting dsDNA fragments are stable (i.e.the complementary strands remain annealed):
How many fragments would you expect upon digestion?
How long would these fragments be (in bp)?

Answer & Explanation Solved by verified expert

4.0 Ratings (624 Votes)

Question 1 a The two palindromes of 6 base pair are 5TGATCA3 5GTGCAC3 Palindromes are the words which read same from both the sides The order of arrangement of words is same from both side that is the reverse of word will be the same as the read from front The restriction enzymes are the specific enzymes which search the DNA strands and cuts it at the specific part Every restriction enzyme has a specific place See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member