Biology question and answers for September 20, 2023
- Q What is plutonium reprocessing? Why is it a big environmentalissue?
- Q What are the main chemical compounds that destroy the ozonelayer?
- Q What environmental damage are caused by mercury pollution? Whatare the main sources of mercury pollution?
- Q What is plutonium reprocessing? Why is it a big environmentalissue?
- Q What is the typical shape of a population growth curve? How canbiotic potential be represented in the same way graphically?
- Q How do biodiversity, the total number of living organisms andbiomass vary during ecological succession?
- Q What are the typical features of the age pyramids ofunderdeveloped countries?
- Q How has this course affected the way you think about biology inyour own life?What new technologies do you think should be developed in thefuture to advance the field of human...
- Q What is the climax stage of an ecological succession?
- Q What is the climax stage of an ecological succession?
- Q How do biodiversity, the total number of living organisms andbiomass vary during ecological succession?
- Q Briefly describe the crosstalk of complement with other immunesystems. How does this affect your understanding of the body as awhole unit, rather than a collection of separate systems?
- Q use TNBS to determine protein hydrolysate(peptide content)，butcan not get results, please analysis what reasons can induce this?
- Q How does biological diversity relate to the characteristics ofthe abiotic factors of an ecosystem?
- Q What are the main causes of the loss of biological diversitynowadays?
- Q Despite having a large amount of biodiversity, why is the AmazonRainforest facing the risk of desertification?
- Q What are the three main types of trophic pyramids studied inecology?
- Q What are the three main types of trophic pyramids studied inecology?
- Q Ls4203_class test_20175. Liver contain both Hexokinase and Glucokinase: catalyzereaction(i.e. glucose + ATP -> glucose-6-phosphate + ADP).Describe how glucokinase and hexokinase regulate blood glucosehomeostasis? How activity of hexokinase and glucokinase isregulated?...
- Q What are the main degenerative diseases of the nervoussystem?
- Q What are primary consumers? Can a food chain have quaternaryconsumers without having secondary or tertiary consumers? Can atertiary consumer of one chain be a primary or secondary consumerof another chain?
- Q What are trophic levels? How many trophic levels can a foodchain have?
- Q Briefly mention about—(a) Genetic diversity,(b) Species diversity,(c) Ecological diversity.
- Q How many mass extinction of species are there on recordssince the origin and diversification of life on earth? How is thepresent episode different? What is the result of loss ofbiodiversity...
- Q Briefly give the views regarding the reasons forconserving biodiversity.
- Q Briefly give the views regarding the reasons forconserving biodiversity.
- Q How many mass extinction of species are there on recordssince the origin and diversification of life on earth? How is thepresent episode different? What is the result of loss ofbiodiversity...
- Q Whyis fixing necessary for most staining procedures?
- Q Suppose you make TSA plates and inoculate them with Escherichiacoli. After incubating the microbe for 24 hours, you notice nothinggrew. What could explain this
- Q Using correct “fly†notation, write the genotype of thefollowing flies.1) Genotype 1: homozygous for yellow body and heterozygous forvestigial wings           2) Genotype 2: homozygous for wild type for body color and...
- Q There are many meteorological (natural) events affecting thebehavior of air pollutants. Describe two conditions that produce orenhance air pollution events. Please cite specific instances.There are also conditions which help to...
- Q Briefly mention about—(a) Genetic diversity,(b) Species diversity,(c) Ecological diversity.
- Q Describe hormone activate receptors in detail
- Q Briefly mention about—(a) Genetic diversity,(b) Species diversity,(c) Ecological diversity.
- Q Which type of organ is spleen? What is its role andfunction in the body?
- Q List the harmful effects caused by alcohol/drug abuse.Ans. Harmful effects caused by alcohol/drug abuse. Drug abusers whotake it intravenously may cause
- Q List some preventive and control measures for studentsregarding alcohol and drugs abuse.
- Q List some preventive and control measures for studentsregarding alcohol and drugs abuse.
- Q What is obesity?How to prevent obesity?prepare a balance diet plan fro yourself that meets your dailyrequirements?
- Q Which type of organ is spleen? What is its role andfunction in the body?
- Q What is vaccination? What is the role of vaccines inbody? Give two examples when immediate response is needed by bodyto defend it, name this type of immunization.
- Q Given the DNA sequence matrix below:Fern AGCCCAGGCTTCGAATGTCCPine AGCTTCAGTGTCGCACTTCCOak AGCTTCAGCGTCACACATCCMoss AACCTTGGTGTCAAACGTCC1. Assuming that Moss is the outgroup, draw all three possibletrees of evolutionaryrelationships among these species. Label your trees A, B,...
- Q What is vaccination? What is the role of vaccines inbody? Give two examples when immediate response is needed by bodyto defend it, name this type of immunization.
- Q Answer each with a few sentences please:1. Epiphyseal plate function and increase in length of a longbone2. Osteoclast functions in bone ECM degradation3. Cells in the osteogenic periosteum and what...
- Q How is a cancerous cell different from a normalcell?
- Q Which of the following is correct order of theevolutionary history of man?(a) Peking man homo sapiens, Neanderthal man, Cromagnon man(b) Peking man, Heidelberg man. Neanderthal man, Cromagnonman(c) Peking man, Heidelberg...
- Q (answer with a paragraph or a few sentences for each)1. The structure of cartilage (in general), how types ofcartilage differ from one another, and the importance of theperichondrium associated with...
- Q Compare and contrast the following macromolecules in terms oftheir structure, function, synthesis and significance to thecell:1. proteins2. carbohydrates3. lipids4. aromatic basesWhich of the above could the cell survive longest without?Why?
- Q Were Lamarck's ideas scientific?How so? How might you test his hypothesis for evolution?
- Q Theory of inheritance of acquired characters was givenby(a) Wallace(b) Lamarck(c) Darwin(d) De Vries.
- Q How are the processes of mitosis and meiosis different?When are each occurring? What is the final product of each? Howdoes each process contribute to genetic variation that makes eachhuman a...
- Q Biochemistry question:Describe the four levels of proteins structure (primary,secondary, tertiary and quaternary). Make sure to describe the roleof non-covalent interactions involving the main chain or sidechains of the amino acids...
- Q Under the interplay of epigenetic regulators:1.In your own words, what is Dnmt1 and what does it do?2.In your own words, what is Dnmt3a and 3b, and what do theydo?3.Identify two...
- Q How did the experiments of Redi and Pasteur refute thespontaneous generation hypothesis?
- Q What are some diseases or genetic abnormalities caused bydominant genes? Why are severe dominant genetic diseases rarer thanrecessive ones?
- Q Why are recombinant DNA technology and nucleus transplantationtechnology still dangerous?
- Q What type of genetic inheritance determines the ABO blood groupsystem? What are the relations of dominance among the involvedalleles?
- Q How are mutagenic agents related to the incidence of cancer in apopulation? Is cancer a disease transmitted to the offspring of anindividual?
- Q A drug that will bind to serotonin receptors only when given atvery high doses, and binds to glutamate receptors only when givenat really low doses likely has a ___ for...
- Q What type of genetic inheritance determines the ABO blood groupsystem? What are the relations of dominance among the involvedalleles?
- Q Why is the Leibovitvz’s L-15 medium is important for adherentcell culture? Identify five key components of this medium. Explainwhy facal bovine serum is added to your medium.
- Q Howdo you set up & determine the results of a dyhybridcross?
- Q 1. List all the reagents (chemicals) and enzymes required tosynthesize DNA. Describe how DNA polymerase works. What does DNApolymerase require in order to polymerize DNA?
- Q Discuss the functions of a forensic scientist. Why should thepolice rely on evidence collected by evidence technicians ratherthan evidence collected by patrol officers or​ detectives? Do youthink all police officers...
- Q it has been noted that in some ballet dancers that the bonedensity is greatly reduced compared to that which is seen inaverage population. suggest reasons for this with an explanation...
- Q A hollow fiber membrane separator with a nominalmolecular weight cutoff of 100,000 is fed a solution of proteins atthe rate of 250 mL min-1 . The composition of the protein...
- Q When doing a lab would you expect all students to have a colonyshowing antibiosis? Explain.andWhat types of microbes are known to produce antibioticcompounds?
- Q 7.You want to set up a PCR reaction.The protocol suggests a 50 µL reaction volume containing 1X buffer,200 µM dNTPs, 0.5 µM each primer (forward and reverse), 250 ngtemplate DNA,...
- Q Wrtie an essay explaining Invasive species managementrestores a plant-pollinator mutualism in Hawaii.
- Q What three reasons, and solutions, for the field of view beingalmost too dark see the image, but one can see light from thelamp?
- Q Consider the cross: A/a; b/b; C/c; D/d; E/e x A/a; B/b; c/c;D/d; e/ea) what proportion of the progeny will phenotypically resemblethe first parent?b) what proportion of the progeny will genotypically...
- Q What are the different nucleic acid monomers that are found inthe cell, what types of macromolecules are they components of, andhow do they base-pair? ​
- Q The lymphatic system has several diseases anddisorders that can affect it. Utilizing your book and othersources, identify at least two diseases or disorders of thelymphatic system. Briefly describe the disorders...
- Q Make 25 mL of a single solution containing 10 mM MOPS [MW=209g/mole]. How many grams MOPS do you need?
- Q Curly wing (CY) shape and stubblebristles (SB) are both recessive lethalalleles (i.e. dominant in terms of wing shape/bristles phenotype,but recessive for lethality). What would be the result(F1 phenotypic ratios) of...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!