Biology question and answers for August 21, 2023
- Q Now describe the flower with these terms: dicot/monocot,complete/incomplete, perfect/imperfect, regular symmetry/irregularsymmetry, florescence?Tell about what type of insect might be the pollinator for thisflower. What type of characteristics would make it...
- Q 14. Contemporary organisms on planet earth encode their designinformation using nucleic acids polymers that have fourdifferent monomers. These monomers are read three at a time toproduce tool polymers – made...
- Q Some people can have atypical karyotypes, which are caused by anerror during one of the processes of cell division. Which processwould an error result in an individual having either an...
- Q You have isolated a protein, JAMP (Just A MembraneProtein), from the plasma membrane of a cell. Describe 3 ways todetermine whether JAMP is a transmembrane or peripheral protein.
- Q A experimental drug XYZ blocks transport of proteinsfrom the ER to the Golgi (anterograde transport), but notGolgi-to-ER trafficking (retrograde transport). Propose 3 possibletargets of this drug
- Q 4) What is bioremediation? What makes some plants particularlyuseful in bioremediation?
- Q The mammalian heart has no valves to control blood entering theatria but does have valves for blood exiting the ventricles.Explain why this adaptation makes sense for efficientcirculation.
- Q 1) a) How might plant adaptations affect the evolution ofherbivores?b) How might the adaptations of herbivores affect plantevolution?
- Q A student was given 6 plates taken from the incubator from aserial dilution done two days earlier and told to get a standardplate count.  The student, not sure what to do,...
- Q explain why the various plants appear the way they do in each ofthe following demonstrations: phototropism: gravitropism:etiolation: holly leaf abscission: leaf movement in the sensitiveplant ( mimosa pudica):
- Q 1. how biotechnology benefits society both medically and inother ways2. how eukaryotic genes can be expressed in bacteria and be ableto describe the process involved
- Q Where in the eukaryotic cell are the chromosomes found?_________________________________________________How many chromosomes are there in a human body (somatic) cell?____________________How many chromosomes are there in a human gamete?__________________If in some species...
- Q Explain the Proton-Motive force across the Innermitochondrial membrane that both generates the H= gradient and aidsIn pulling H+ back Into the mitochondria matrix
- Q Why can the inside of the endoplasmic reticulum functionally bethe same as the outside of the cell
- Q What is wrong with the traditional historical geology view thatsuccessive petrified fossil forests at Specimen Ridge, Yellowstonewere created by volcanic eruptions which buried and petrifiedforest trees right where they stood...
- Q Give an account of the sequence of events that pertain annuallyin coastal wetlands in Ghana indicating how they drive the lifecycle of inhabiting organism
- Q The genetic code is (almost) universal, meaning that ribosomesfrom bacteria, fish, mice or humans will translate a particularopen reading frame into identical proteins. However, it is notpossible to place a...
- Q Subject: Nutrition-NSQuestion: Salmonella causes food poisoning and write full detailsabout the bacteria?
- Q Answer questions 5-9 below using the information in thisexperimental description. Dr. Meyer wants to study theeffect of Kava root on insomnia. She recruits 150 people whoexperience long term insomnia (more...
- Q Using the sequence below give an example of an insertion,deletion, SNP, inversion, and translocation.3’-ATTCGGCCAGTTAGCCGATG-5’
- Q How is light energy trapped by plants and used by thechloroplast membrane to generate ATP and NADPH?Why do photosynthetic pigments only trap certain lightwavelengths?
- Q Describe stages in biofilm formation and explain how, at themolecular level, bacterial cells within the biofilm communicatewith each other. .
- Q Describe the key properties of a signal sequence (or leadersequence or leader peptide). Explain the roles of these propertiesin guiding proteins across the cytoplasmic membrane. .
- Q Which of the following ion channels are always sensitive tosmall changes in electric charge?A. stress-activated channelsB. ligand-gated channels with extracellular ligandsC. voltage-gated channelsD. ligand-gated channels with intracellular ligandsE. all of...
- Q We know that the supply of dietary supplements is endless, andexpensive. Jordan decided to eat healthy food regularly to avoidthe need for buying supplements. He decided that it would be...
- Q In regard to guevedoce, why is it important that the parents arerelated and from the Dominican Republic? How is the diseaseinherited - mode of inheritance? (To describe the mode ofinheritance,...
- Q Create an experimental design to determine protein expression?Using high throughput or low through put.Please explain in detail
- Q State the roles of proper food preparation and sanitationplay in the decrease of microbial digestive tractinfections.What is the significance of capsule on particular strains ofe.coli that causes digestive tract infections...
- Q what are the domains and subunits of alpha amylase?...bothsalivary and pancreatic with the functions for each domain andsubunit.
- Q For Glycolysis, TCA cycle and Electron Transport, be able toname all the intermediates and what each step consumes or releases(NADH, ATP etc) Know the differences between GLUT 1, 2, 3...
- Q please i want computer typing answer with details andexplainCompare and contrast the oxygen binding pockets of myoglobin andhemoglobin.
- Q Bacteria can perform aerobic and anaerobic respiration dependingon their enzymes and metabolic needs. A student argued that aerobicand anaerobic respiration should produce the same amount of ATP. Hereasoned that they...
- Q IMMUNOLOGY QUESTION.Give the mechanism of action and the result for each of thefollowing therapeutic agents used to treat type I hypersensitivityreactions. a) Antihistaminesb) cromolyn sodiumc) theophyllined) epinephrinee) cortisoneI asked this...
- Q People continue to take up smoking even though it has been knownfor over 40 year that smoking causes cancer and there is a warningon every pack of cigarettes. \"Should lawsuits...
- Q 2. what are the difference between heterochromatin andeuchromatin and how this influences gene expression?3. how chromatin modifications can influence geneexpression?4. why start and stop codons are important?5. how differential gene...
- Q You have a protein, which has high affinity to DNA. You preparedresin attached with a small piece of DNA. After allowing theprotein to bind to the resin, how would you...
- Q Explain the stages needed to establish microbial infections.Classify bacterial toxins. Provide two examples and describe theirmechanism of action on mammalian cells.
- Q Phytochemical and antimicrobial properties of garlic
- Q What cell growth do we expect to see in the agarose coveredplate? suspended?
- Q Aerobic RespirationStepsWhere in the cellInputs or ReactantsOutputs or ProductsNet ATP Produced1. GlycolysisCytoplasm2. PyruvateOxidation3. Citric Acid or Krebs Cycle4. Electron Transport Chaint Chain
- Q Your local senator is calling for an immediate ban on all animalstudies proposing that all experiments should be done using cellcultures. Explain to the senator why cell culture may not...
- Q what are two components that are present in botheukaryotic/prokaryotic gene regulation, and what is one that isspecific to eukaryotic only?
- Q how a single reading frame can contain multiple openreading frames? Differentiate an open reading frame from a readingframe.
- Q why length of each phases are different in mitotic division?tell about each phases prophase, prometaphase, metaphase, anaphaseand telophase.
- Q isit true or false;Any deletion mutation in the coding sequence of a proton willresult in a protein sequence change
- Q Sickle-cell anemia is an interesting genetic disease. Normalhomozygous individuals (SS) have normal blood cells that are easilyinfected with the malarial parasite. Thus, many of theseindividuals become very ill from the...
- Q I need an essay about 300 words for this topic : DNA Secret ofPhoto 51
- Q 1) a) Describe the adaptations xerophytes and halophytes have totheir environments. Which adaptations are common to both?b) What are the problems associated with high or lowtemperatures and what are the...
- Q In addition to climate change, polar bears also face threatsfrom pollution. Use the Internet for research and write a three- tofour – paragraph report describing two ways in which the...
- Q Arethere any differences in how these two types of carbohydratesdeliver their “glucose†to the body? Which type makes glucoseavailable more quickly? Which type makes glucose available over alonger time period?
- Q What is the main purpose of chromosome pairing in meiosis I?Group of answer choicesFor crossing over to occurFor proper chromosome segregation to occurFor mitosis to occurFlag this QuestionQuestion 291 ptsMale...
- Q Topic : recent advance in Genetics ( write a review on it morethan 800 words) Please answer the question only if you can observethe minimum limit of 800 words. Thank...
- Q Question 30:A. Describe the secondary structural characteristics of B-formdouble-stranded DNA.B. Explain how to determine the number of supercoils present ina molecule of DNA.C. Explain/demonstrate how to determine changes in linkingnumber...
- Q 1. Describe how attaching an enzyme to the cell membraneregulates the rate of a specific reaction2. Describe the type of reaction that is typicallyregulated by an allosteric enzyme based on...
- Q What is your favorite food? Use proper terms to describe itssensory aspects. Which sensory attributes agrees with your taste?Which sensory attributes do you use to judge the quality of thisfood?...
- Q Which of the following eukaryotic sequences would you predict tohave the longest “life-time†(stability) in the cytoplasm: Selectone:a. 5’ AUGGCCCGGAAACAAAAAAAAAAAAAAAAAAAAAAA 3’ b.5’GTCACGATCGACTAGATCGACTGACTGACTGCTAGCATACTACTAAAAA 3' c. 5’GCUAUAACGUGGAAAAAAAAAA 3’ d.3’GCUCCUCUAUCACUCUACUAAACAAAACAAGUAAAAAAAAAAAAAAAAAAA 5’
- Q Homo erectus (Anthropology)Describe the physical characteristics of Homo erectus.How does this species compare to earlier hominins and to modernhumans (Homo sapiens)?Explain why losing body hair and being able to sweat...
- Q Can you please explain the molecular components involved in thepathway of SsrA-tagged protein degradation in Vivo? Including theadaptor protein SspB and delivery to ClpX and subsequentdegradation by ClpP.
- Q 3/.Thehypothalam0-hypophyseal portal systema.Allows hypothalamicreleasing hormone to directly stimulate the anterior pituitarywithout entering the systemic circulationb.Provides a directlyblood supply between the hypothalamus and posterior pituitaryglandc.Allows for negativepituitary feedback regulation between the...
- Q A chromosomally XY fetus with normally functioning testes has amutation in the androgen receptor so it can't respond totestosterone (but it can still respond to MIS). Which of thefollowing WILL...
- Q What do both G protein-coupled receptors and tyrosine kinasereceptors have in common?The binding site for the signaling molecule is located on theoutside of the cell.They both interact with G proteins.Binding...
- Q Why is the interconnectedness of the brain critical tohigher order function?
- Q When a heterozygous Aa diploid cellundergoes mitosis, what are the genotypes of the mitoticproducts?Group of answer choicesAa (product 1) and Aa (product2)AA (product 1) andaa (product 2)AA (product 1) andAA...
- Q Answer the following questions in at least two paragraph (Be asdescriptive as possible)Compare the structure of DNA and RNA. Explain how the structureof tRNA correlates to its function? Discuss any...
- Q BIO REVIEW SHEET 4Define “taxonomyâ€.Define “binomial nomenclature†and know how to properly writean organism’s scientific name.List the major taxonomic categories or the current hierarchicalclassification system, from the most to least...
- Q The list below describes (in no particular order) someearly events of the pre-embryonic period.1 – Cortical reaction2 – Blastocoel forms3 – Yolk sac and amnion start to form4 – Dichorionic-Diamnionic...
- Q How is co-expression induced?
- Q Briefly discuss two mechanisms of post-translation modificationof protein synthesis.
- Q Identify toxins important to GI tract diseases. What role(s) dotoxins play in GI tract infections?
- Q what is body segmentation? in what structures is segmentationrepresented in the bodies of annelids, arthropods andvertebrates?
- Q Explain the precise meaning of the statement “The heritabilityof height in humans is 0.85â€. In your answer you should indicatewhat proportions of the total phenotypic variance in heightobserved in the...
- Q Give a brief background on GMOs. What are they? What role dothey play in our food production?What are the Benefits/Drawbacks?Do you think genetic modification experimentation is “unnaturalâ€or interferes with the...
- Q Describe the steps of how eukaryotes control gene expression usingtranscriptional and post transcriptional .Explain in details steps clearly and if possible compare it to whythey use this and not OPERONS
- Q What’s the “respiratory quotient†and why does it varydepending upon the kinds of food used to provideenergy?What other factors affect the respiratory quotient?On average, why is the volume of air...
- Q Describe NAD+, NADH, NADP+, NADPH. And how NADH is used forcatabolism mainly, while NADPH is used for biosynthesis.
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!