Biology question and answers for November 15, 2023
- Q The deficits in memory performance of persons with Alzheimer's diseaseaffect all memory systems equallyare particularly severe with respect to learning new skillsfluctuate, suggesting attention may play a roleO are more...
- Q In 1944 Avery, MacLeod, and McCarty performed transformation experiments using live, harmless bacteria and extracts from virulent bacteria treated with various enzymes. Which of the following enzymes were used and...
- Q The DNA molecule has a ladder-type structuralorganization. Each rung of this ladder represents(1) alternating phosphate and glucose molecules(2) a pair of nitrogenous bases(3) ribose molecules(4) a random organization of proteins...
- Q The two scientists that are credited with the discovery of the structure of DNA arenamed:Watson and CrickWatson and PaulingCrick and FranklinCrick and Wilkens
- Q Miescher was one of the first scientists to notice that genetic material consisted of a basic protein portion. We now know that this class of proteins is responsible for packaging...
- Q What effect would the addition of lactose have on a repressed lac operon? a. It would reinforce the repression of that gene b. It would have no effect whatsoever. c....
- Q Which of the following nucleotide triplets best represents a codon?a triplet separated spatially from other tripletsa triplet in the same reading frame as an upstream AUGa triplet that has no...
- Q What is the active site of an enzyme?What is a substrate?Enzymes increase the rate of a reaction by (choose one answer below):A. decreasing the activation energy needed to start the...
- Q which of the following best describes the structure of the ribosome: prokaryotic and eukaryotic ribosomes are made of different sets of proteins eukaryotic ribosomes are smaller than porkaryotic ones made...
- Q Capillaries are ideal for separating DNA molecules due to a variety of reasons.Mark ALL that apply:Enhanced resolution due to sample stacking.Automatibility"Greenness" - Components are made from recycled plastic.Faster runs due...
- Q Q5. Humans carry a variety of non-functional genetic sequences, called processed pseudogenes, in their DNA. We can estimate how long ago these sequences first appeared in the genomes of our...
- Q As a ribosome synthesizes a protein (moving left to right across an mRNAtranscript), the _____ is oriented to the left of the ribosome.Hint: Which end of an amino acid is...
- Q Trisomy 21, or Down syndrome, occurs when there is a normal diploid chromosomal complement but one extra chromosome 21. While there is reduced fertility in both sexes (considering individuals with...
- Q Which ONE is the description of a nucleotide?A. A subunit bead within the beads on a string chromatinB. A spherical organelle containing all of a cell's DNAC. A particle composed...
- Q could you give a detailed explanation on how you got your answer. Thank you I will like right after.A mutagen changes a C-G basepair in the genome to an A-T...
- Q A short segment of DNA from a prokaryotic genome is shown below. Assume this is part of a muchlonger sequence.TTAAACGCTG CCCGGCGAATTAATTTGCGAC A GGCCGCTTAAPick the correct statement from below.Mismatch repair enzymes...
- Q 1-12 Two-year-old Janice Tumminello survived an episode of Haemophilus influenzae septicemia at 4 months by intravenous antibiotic therapy. Her immunizations are up to date. Three days ago her adoptive parents...
- Q A section of the template strand of the functional CCR5 gene has the sequence below. Determine the amino acid sequence that would be produced from this section of the gene....
- Q David Pribnow studied the base sequences of promoters in bacteria and bacterial viruses. He found two conserved regions in these promoters (the -10 box and the -35 box). These two...
- Q Imagine that you are a genetic counselor, and a couple planning to start a family comes to you for information. Jerome was married before, and he and his first wife...
- Q The sugar-phosphate backbone of the RNA has a 5' end with a free _____ and a 3' end with a free _____.phosphate group... hydroxyl groupamino group... carboxyl groupcarbonyl group... methyl...
- Q Q4.8. DNA replication involves a series of steps, including initiation, making primers, extension, and connecting DNA fragments. The cell uses different enzymes in a particular order to accomplish these steps....
- Q The sequencing of the human genome has been instrumental towardChoose one: A. the field of individualized/personalized drug development. B. our understanding of the genetic basis of disease. C. better genetic...
- Q At the very beginning of translation, the first tRNA molecule attaches directly to the DNA codonbinds to the mRNA's start codon connects an amino acid to its anticodonbinds to the...
- Q In 1951, four scientists were working on solving the structural puzzle of the DNA molecule. Two of those scientists had worked for many years to try to solve the puzzle,...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!