A short segment of DNA from a prokaryotic genome is shown below. Assume this is...
50.1K
Verified Solution
Link Copied!
Question
Biology
A short segment of DNA from a prokaryotic genome is shown below. Assume this is part of a muchlonger sequence.TTAAACGCTG CCCGGCGAATTAATTTGCGAC A GGCCGCTTAAPick the correct statement from below.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the LOWER strand is more methylated.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the TOP strand is more methylated.Repair is not possible for a mutation like the one shown in the middle of this double-stranded molecule.
A short segment of DNA from a prokaryotic genome is shown below. Assume this is part of a muchlonger sequence.TTAAACGCTG CCCGGCGAATTAATTTGCGAC A GGCCGCTTAAPick the correct statement from below.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the LOWER strand is more methylated.Mismatch repair enzymes will remove part of the strand containing the C from the TOP strand assuming the TOP strand is more methylated.Repair is not possible for a mutation like the one shown in the middle of this double-stranded molecule.
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
Other questions asked by students
StudyZin's Question Purchase
1 Answer
$0.99
(Save $1 )
One time Pay
- No Ads
- Answer to 1 Question
- Get free Zin AI - 50 Thousand Words per Month
Unlimited
$4.99*
(Save $5 )
Billed Monthly
- No Ads
- Answers to Unlimited Questions
- Get free Zin AI - 3 Million Words per Month
*First month only
Free
$0
- Get this answer for free!
- Sign up now to unlock the answer instantly
You can see the logs in the Dashboard.