Biology question and answers for March 26, 2024
- Q A hawk has a genetic trait that gives it much better eyesight than other hawks of the same species in the same area Explain how this could lead to evolutionary...
- Q What are the disadvantages of using biomass as a source of heat Select all that may apply Initial cost of building infrastructure is high It is less expensive than oil...
- Q OUsed in two factor crosses O Pure Breeding plants Homozygotes
- Q What is a disadvantage of lithium batteries Lithium batteries may explode and are dangerous Lithium batteries are cheap to make The batteries don t store much energy Lithium is a...
- Q Why must the protein complexes in the electron transport chain be arranged in order of increasing electronegativity A
- Q pages the Bible Montag rips the pages to try to force Faber to help him Montag wants to destroy the evidence that he ever had the Bible Montag does not...
- Q Which of the following are the abiotic components of an environmen Select all that apply A B C C bacteria gasses light
- Q True or False Taxonomic categories should ideally reflect evolutionary relationships Scientists need to rely on other characteristics to categorize relationships A B True False
- Q show a cross of these two blood types You can earn up to 5 points C 0 00 0 27 02 P PENCIL THIN Speed 1x BLACK etchpad below to...
- Q A 43 year old man is diagnosed with chronic myeloid leukemia CML and started on standard imatinib therapy tyrosine kinase inhibitor TKI Which of the following clinical findings indicate this...
- Q These structures are A male gametophyte plants B ovules C seeds D embryos
- Q What are the potential ecological impacts of wind power Select all that may apply Disruption of scenery Wind turbines cause cancer Risk of injury death to birds and bats Noise...
- Q www from mitochondria leads to apoptosis by activatin
- Q 43 Describe antigenic variation and how Trypanosoma uses this to cause disease
- Q Describe the pathogenic mechanisms of the two E coli pathovars EHEC and EPEC Discuss how the spreading of pathogenic E coli from its main reservoir can be reduced
- Q C A U 5 TACAGCTATGTAATTCTGTAACAT 31 3 AUG UCG AVA CAV VAA GAC AVV GUA S S AUG UVA CAG AAV VAC AUA GCU GUA 3 B What would be...
- Q What is the BEST word to describe the television programming that Montag sees on the walls SELECT AN ANSWER O depressing O peaceful O chaotic joyful
- Q Read each statement below and determine which type of market structure it is describing Write PC for Pure Competition MC for Monopolistic Competition O for Oligopoly or M for Monopoly...
- Q All animals biotic factors breathe in oxygen abiotic factor All plants biotic factor absorb carbon dioxide abiotic factor and need water abiotic factor to survive TEXT ANSWER Create a list...
- Q True or False A nonsense mutation happens when a nitrogenous base is changed in the DNA but the amino acid encoded is not change in the protein
- Q 27 Which of the following areas of the body would you expect to be axenic in a healthy person A lleum B Nasopharynx C Trachea D Ureter E Urethra 28...
- Q 4 A particular antibiotic kills 90 of a population of infection causing bacteria in abo 2 days Assuming the person continues to take the antibiotic as prescribed what would you...
- Q Sea Lion Population Size in thousands a 100 000 b 125 000 325 300 275 250 225 200 175 150 125 135 000 100 III 75 50 20 Figure 1...
- Q 22 Tetanus toxin works by A Directly stimulating muscle contraction B Preventing inhibitory nerve impulses C Preventing release of acetylcholine D Stimulating a large number of T cells E Targeting...
- Q 13 Which of the following is not a characteristic of a typical exotoxin A It can be released by Gram positive or Gram negative bacteria B It can cause disease...
- Q 3 Chicken pox is caused by varicella zoster virus and it affects humans during their childhood However shingles is manifested in adult people Why a Chronic condition b Recurrence c...
- Q In 1918 the Spanish flu spread around the world killing an estimated 50 million people This is an example of a an disease A Endemic B Epidemic C Pandemic D...
- Q 15 Rb is considered a tumor suppressor gene product because it prevents progression through the cell cycle How is this inhibition relieved so the cell can divide
- Q Read the following line and answer the question that follows I was a man once I m a beast now and they made me what I am Who speaks these...
- Q Read the following lines and answer the question given below Convict Ah thanks thanks Monseigneur I I Ah I m a fool a child to cry b somehow you have...
- Q 960 ENGAGE What happened when wolves were introduced to Coronation Island Coronation Island is a small island 116 km off the Alaskan coast A resident black tailed deer population had...
- Q Differentiate between HIV 1 and HIV 2 Include their probable origins and any differences in disease presentation or development 2 pts
- Q Biology Deduce and explain the effects of mutations in lacy that causes transcription to terminate in the middle of the gene
- Q 7 The results of endotoxin in the body can include A Drop in blood pressure B Fever C Internal blood clotting D A and B E All of the above
- Q 57 Which color of visible light has the shortest wavelength and highest energy 58 What is the primary difference between radio waves and microwaves 59 What is the primary difference...
- Q 25 What should you do if an emergency vehicle is approaching you from behind with sirens and flashing lights stop Pull over to the curb or edge of the road...
- Q Beep your horn Expect the child to be in total control of the bicycle
- Q Question 23 of 25 23 You can identify aggressive drivers by Erratic and improper lane changes The number of passengers in their car Their tendency to drive slow
- Q sleepy while driving is Getting rest or changing drivers
- Q Question 21 of 25 21 BAC means Blood alcohol concentration Blood alcohol content Blood alcohol conservation
- Q Question 18 of 25 18 This road sign means STOP
- Q Question 16 of 25 16 This road sign means n
- Q tion 15 OT 25 5 This road sign means LEFT TURN YIELD ON GREEN Yield before turning left at a green signal
- Q newer vehicles to prevent crashes Now if your mind wanders your car won t Lane keeping assistance helps save lives Automatic emergency braking and lane NHTSA
- Q passing another vehicle you should Been your horn
- Q 11 You are car A and the traffic in front of you is stopped You should A B Move up and stop between the railroad crossing gates in case they...
- Q 10 In inclement weather you should Steer off the road
- Q highway with its lights flashing move over or slow down there CO MOMARYLAND DEPARTMENT OF TRANSPORTATION Flash your high beams so they know you are Maryland motorists must move over
- Q Brake as hard as possible Allow the vehicle to slow to a manageable speed
- Q 7 How can you keep vehicle technologies operating at their peak Now if your mind wanders your car won t KOI 7
- Q O Always use your high beams Look directly at the headlights of the
- Q 11 ICY CONDITIONS MAY EXIST Follow the posted speed limit
- Q 4 The maximum posted speed limit should be driven only During the night During the day
- Q You cannot make a U turn on a curve or a hill where your vehicle cannot seen at least away by the driver of another vehicle proceedi in either direction...
- Q If we had only 2 different DNA RNA nucleotides e g A and T strings of how many nucleotides would be required to uniquely encode all 20 amino acids i...
- Q Imagine that you repeat Seymor Benzer s tRNA Selection experiment with modifications as follows 1 Synthesize mRNA containing A s and G s only poly AG in random order 2...
- Q Pick an activity outside of an organized sport that you enjoy Middle The title of the activity and some words pictures or art to go with it Upper Left Who...
- Q In a certain mutant strain of bacteria the enzyme Leucyl tRNA Synthetase mistakenly attaches cysteine to leucyl tRNA instead of leucine The result would be that Protein synthesis will stop...
- Q How many codons in our genetic code encode amino acids 16 20 61 64
- Q What two animals would fit in this type A bee and flower B M C tick and human wolf and moose
- Q 22 Referring to the genetic code presented in Figure 15 10 give the amino acids specified by the following bacterial mRNA sequences a 5 AUGUUUAAAUUUAAAUUUUGA 3 b 5 AGGGAAAUCAGAUGUAUAUAUAUAUAUGA 3...
- Q 3 How might pregnancy influence a urinalysis test result
- Q 7 Look up the following organisms Paramecium Spirogyra Oscillatoria Saccharomyces Which one of these organisms has no organelles 8 Which of these molecules is a polymer glucose amino acid glycogen...
- Q 70 Cells that go through mitosis do not possess homologous chromosomes True or False 71 A parent that is homozygous dominant for a trait cannot have a child that expresses...
- Q The vaccine against tetanus is this kind of vaccine O Inactivated O Toxoid O Attenuated
- Q 72 What term is used for programmed cell death 73 Which pattern of inheritance results in a blending of two phenotypes in heterozygotes that presents an intermediate form codominance incomplete...
- Q 1 Viruses are not living organisms but they do have one characteristic of life that makes them difficult to eradicate Which characteristic is it
- Q 3 1 point There are 4 amino acids below Draw a large RECTANGLE around the one Polar amino acid Draw a large CIRCLE around the one Basic amino acid CH3...
- Q 4 What term do we use for the electrons in the outermost shell of an atom 5 Suppose one atom of P has an atomic mass of 31 and another...
- Q Crumb pickers O A Are scavengers B Have high giving up densities C Have low giving up densities OD Are mesopredators
- Q 22 Which of these is an example of simple diffusion A the movement of small bacteria away from high concentrations of solutes B the spread of a gas through the...
- Q Acid A red B green When using Universal Indicator Paper acids will react and turn the paper C blue The pH Scale D silver 10 Bas II
- Q 1 point Match the correct RNA bases to this DNA strand T A C C A T A G A T G G G
- Q 1 point Match the correct DNA bases to this DNA strand A G T C A T G T T G C A
- Q The firmware on one of your network routers is out of date so you download the latest version of the firmware from the manufacturer s website Which order should you...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!