Biology question and answers for June 28, 2024
- Q Answer the following prompt in a three sentence paragraph Which faction was the best when it came to both exploration and expansion 15
- Q psiho
- Q SA Generics have the same active ingredients as the brand name Generics offer savings to patients over the brand name product Generics are the trade names of each drug Question...
- Q Now that you ve learned about the requirements of a personal narrative essay it s time for you to write your own Remember that a personal narrative should focus on...
- Q We know that one large category of American commercials are those that try to convince you to choose particular medications For this Ulcers and Antacid assignment you are going to...
- Q 1
- Q a How does the process of cellular respiration compare with the process of photosynthesis The process of cellvor respiration occurd in Juitochon chic gluat AID Phodyen the si s guves...
- Q What factors limit the rate of photosynthesis Why
- Q 21 For each label the structure and state its individual function B D AIRWAY E 90 urime Imm Bodo oodat Tuv vee A aerrein C
- Q Explain how these structures model an alveolus Red and blue paper Balloon O Straw
- Q capillary V II I III
- Q X 81
- Q When homologous chromosomes fail to separate during meiosis occurs Your answer 1
- Q The offspring of two different true breeding plants that differ in only one characteristic is called Your answer is a portion of a DNA molecule that carries the information that...
- Q Asexual reproduction is the production of offspring from the fusion of two sex cells O True O False Genotype refers to an individual s outward appearance with respect to a...
- Q Trisomy is a chromosomal abnormality in which there is a single chromosome in place of a homologous pair O True O False Sexual reproduction is the production of offspring from...
- Q A monohybrid cross is a cross designed to study the inheritance of only one 1 point trait O True O False A zygote is a pair of homologous chromosomes each...
- Q An organism in which the genetic material has been altered using genetic engineering techniques is called a genetically modified organism O True O False Meiosis involves two divisions that produce...
- Q During anaphase I of meiosis the tetrads migrate toward the center of the 1 point cell and align their centromeres across the middle of the cell True False Cloning is...
- Q Deoxyribonucleic acid is a molecule that carries genetic information in cells True False Cytokinesis is the portion of the cell cycle between mitotic divisions when the genetic material is duplicated...
- Q Interphase is the process in which a eukaryotic cell divides its cytoplasm into two new daughter cells True False
- Q An allele that if present is always expressed is called a recessive allele O True False
- Q Two heterozygous purple flowered yellow seed plants are crossed Which 1 po of the following has the greatest probability of being produced a plant with white flowers and yellow seeds...
- Q Which non disjunction disorder does the individual with this karyotype have XXXK 3 2 5 Y 8 9 10 12 115 14 13 15 16 17 11 41 1 19...
- Q Which chromosome abnormality does this karyotype show XXXK Y 8 9 10 11 SC Ir J 7 13 18 14 15 16 11 19 20 21 1 22 5 11...
- Q A parent that is RrPp can produce which gametes Rr RP Rp rP rp and Pp ORP and rp only Rr and Pp only RP Rp rP and rp
- Q Which of the following is a possible cause of a mutation errors during cell division environmental agents chemicals all of the above
- Q Which statement is true regarding a dihybrid cross O A dihybrid cross has no relationship to a monohybrid cross O A dihybrid cross involves two genes and up to four...
- Q Which term refers to a chromosomal abnormality in which there are three homologous chromosomes in place of a homologous pair zygote trisomy monosomy tetrad
- Q Which term describes the passing of traits from parents to offspring O polyploid non disjunction locus heredity
- Q k 1p Which term describes the failure of homologous chromosomes to move to opposite poles of the cell during meiosis O fragmentation O nondisjunction crossing over cytokinesis
- Q Matching Match each figure to the correct phase of meiosis Answer choices may be used only once a anaphase I b anaphase II c metaphase I d metaphase II e...
- Q X 4 In order for photosynthesis to occur carbon dioxide from the atmosphere has to enter a leaf on the plant Which shows the correct pathway that the CO2 molecules...
- Q No GFP 100 25 10 4 2 Counts Counts Counts Counts 50 100 0 10 Counts 50 0 10 100 50 100 0 10 10 50 10 100 10 0...
- Q 27 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGCCGCACACUAGUUGC 3 Translate this sequence What type of mutation is this I
- Q 0 21 The original DNA mutates to form the following strand of mRNA 5 GGUAUGGGCCCGCACAAUAGUUGC 3 Translate this sequence What type of mutation is this
- Q 10 Eye color red or white in the fly Drosophila is determined by the X chromosome The dominant version of the allele XR causes red eyes while the recessive allele...
- Q Which of the following questions can be asked about organisms that live in fresh water Will their bodies take in too much water Can they control their tonicity Can they...
- Q 7 Identify the principal driving movement in diffusion such as Extracellular fluid Lipid bilayer plasma membrane Time depicted here concentration gradient membrane surface area particle size temperature O Cytoplasm 0...
- Q Unit Chemical Writing Formula Equations WS 1 Directions Convert the following word equations into formula equations by changing element and compound names into chemical formulas 1 sodium oxygen sodium oxide...
- Q How would an organism maintain membrane fluidity in an environment where temperatures fluctuated from very high to very low Greater proportion of unsaturated phospholipids in membranes Greater proportion of saturated...
- Q 1 Which plasma membrane component can be either found on its surface or embedded in the membrane structure carbohydrates cholesterol glycolipid protein 2 In addition to a plasma membrane a...
- Q Directions Balance the following equations Nal F2 NaF 1 2 3 4 S Pb ClO2 4 Li OH Reactions Balancing Equations WS 2 Cr N 1500 Zn SO4 Li O...
- Q Discuss the characteristics of each of the following biomes to include soil type annual rainfall mean temperature and biotic features Chaparral savanna taiga temperate forest temperate grassland tropical rain forest...
- Q Discuss ecological succession and compare the effects of primary succession versus secondary succession
- Q Discuss species diversity Give an example of what can happen when agricultural diversity is ignored
- Q Describe the mechanisms by which human population growth and resource use causes increased extinction rates
- Q 4 Ionic compounds In the chart below write the ionic formula if it gives you the ionic compound name Write the ionic compound name if it gives you the formula...
- Q What is true about the semiconservative model of DNA replication occurs through the addition of nucleotides to the end of the parental DNA molecule results in the formation of four...
- Q Study guide The following are the topics you need to know and understand These are the areas that will be covered on the exam 1 List the steps of the...
- Q 14 Significant figures and scientific notation a How many significant figures are in the following i 5004 ii iii iv V 0 00984 20 000 3 000546 15849 b Write...
- Q 7 Know how to use a periodic table What is a period What is a group Trends in the elements on the table 8 What is an atomic number atomic...
- Q Gene therapy detailed information about the structure organization and function of the complete set of human genes the process of determining the precise order of nucleotides within a DNA molecule...
- Q What technique is used to find out where a protein or RNA is expressed cell culture DNA sequencing polymeraze chain reaction immunofluorescence
- Q The genetic code is unambiguous nearly universal redundant All of the above
- Q The following are needed for translation to occur EXCEPT Ribosomes transfer RNA messenger RNA RNA polymerase
- Q O Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue detailed information about the structure organization and function of the...
- Q The following mechanisms are levels at which gene expression can be regulated EXCEPT Transcription Translation RNA processing None of the above
- Q DNA replication requires which of the following DNA polymerase and helicase RNA polymerase and helicase Ribosomes and RNA Transcription factors
- Q Match term with description Cell culture Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue the process of determining the...
- Q Which of the following best depicts the flow of information of gene expression RNA DNA protein DNA RNA protein protein RNA DNA RNA DNA protein
- Q Used to study the expression of interacting groups of genes Used to detect the presence of proteins in tissue detailed information about the structure organization and function of the complete...
- Q RNA PROCESSING involves which of the following A addition of a nucleotide 5 cap to the molecule B addition of a poly A tail to the molecule C RNA splicing...
- Q Match the term with their decription promoter DNA packing and methylation Telomeres Polymerase chair reaction PCR Choose DNA packing and methylation Control sequence where RNA polymerase attaches and initiates transcription...
- Q What would happen if ribosomes DO NOT bind to mRNA nothing will happen Proteins will be translated Translation will not occur
- Q Mistakes during DNA replication can cause mutations in the DNA can lead to which of the following A abnormal development B Cancer C There is no effect D A and...
- Q Which of the following statements best summarizes the structural differences between DNA and RNA A RNA is a double helix but DNA is single stranded B DNA is double stranded...
- Q Muscle cells and nerve cells in one species of animal owe their differences in structure to having different chromosomes using different genetic codes having different genes expressed having unique ribosomes
- Q Which of the following statements is true about base paring in DNA Guanine G binds to Adenine A whereas Thymine binds to Cytosine C Adenine binds to Thymine T wheras...
- Q Females need of a recessive sex linked gene to express the recessive phenotype one copy two copies throo conic
- Q a Explain how biotic and abiotic factors can impact growth of populations biotic Predation Competition for seagant bPotic Climate availibity of nutrients 01 b How does one feeding niche impact...
- Q Duchene s syndrome color blindness and hemophilia are examples of disorders caused by a recessive sex linked gene dominant autosomal disorder diet exposure to radiaation
- Q 7 Cecum lab what evidence can you use to identify which feeding niche an organism occupies a Explain the difference in digestive tracts between herbivores omnivores carnivores
- Q 13 Tusklessness Explain how humans can be a selective pressure that changes animal populations
- Q 11 Food web food chain explain how human activities can affect a food web or food chain
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!