Biology question and answers for January 03, 2024
- Q Arrange the images representing the organization of eukaryotic genetic material from smallest to largest Jamamala x
- Q Pyruvate ATP Glucose Triglycerides Glycogen Acetyl CoA Proteins Blood lipid levels elevated LIPIDS Insulin CARBOH
- Q Among the various reasons postulated by Bredesen for the failure of effective treatments for Alzheimer s disease and other neurodegenerative diseases thus far is O Attempting to treat with a...
- Q Study the two graphs in Figure 1 showing the Finch population Figure 1 Daphne Finch Beak Depths 1976 and 1978 Pop Figure 1 Daphne Finch Beak Depths 1976 and 1978...
- Q Ononcovalent TAP O covalent invariant chains Ononcovalent beta2 microglobulin Ocovalent beta2 microglobulin Question 13 2 points Listen The main function of helper CD4 cells is to secrete O complement proteins...
- Q What color is a non spore forming bacteria Green Purple A
- Q Water has unique properties that prevent lakes from freezing solid protecting the marine life within Which statement listed below explains this concept A Water has a special membrane C Water...
- Q atom Oxygen is a highly electronegative What influence does this property have on water molecules A Confers polarity C Confers a linear shape B Confers low specific heat D Confers...
- Q 827 Water moves against gravity through plants like blood moves through your body This is an example of A cohesion only C polar on polar interaction Badhesion only D both...
- Q is prepared by copying an mRNA template Dis typically prepared using a poly dT primer is conserved DNA is double stranded DNA that represents a mRNA molecule is the fist...
- Q Why is water considered to be the versatile solvent OQU B Its nonpolar covalent bonds allow for a strong attraction to most nonpolar substances like dissolves like A Its molecular...
- Q Ethylene oxide is e the active agent in household bleach sporicidal a halogen only effective with high heat used as an antiseptic against anacrobes
- Q Why do fat cells and nerve cells have different structures and functions OA Fat cells lack DNA and rely on nerve cells for their genetic instructions B Different sets of...
- Q Which statement best describes the difference between gene regulation in prokaryotes and eukaryotes OA Prokaryotes use transcription factors while eukaryotes mostly group genes into operons B Prokaryotes have promoter regions...
- Q NHZ is defined as the Nominal Hazard Zone Select one O True False
- Q Class 4 lasers are the most hazardous laser Select one True False
- Q You counted 5 cells on one large grid of the hemocytometer The sample was diluted 1 1 in trypan blue What would be your final cell ml concentration of the...
- Q Question 2 Not yet What is true of the proteins illustrated in the diagram belo
- Q Every eukaryote that has been studied has an ortholog of SPO11 but it is very difficult to obtain and maintain a mutation that knocks out the function of SPO11 What...
- Q During photosynthesis in plants what is the source of the carbon in the glucose sugar molecule C6H1206 O Carbon particles in the soil O Carbon dioxide in the air Carbon...
- Q Which compound is a reusable complex protein that speeds up chemical reactions a sugar O a lipid starch an enzyme
- Q 2 What enzyme breaks peroxide H O2 into oxygen 0 and water H O 3 A noncompetitive inhibitor changes the shape of so it does not fit with the substrate...
- Q courses SC BIOL1000 N Biology I Cells Molecular Bio You apply a restriction endonuclease enzyme to a sa gol plectrophoresis to check for the number of DNA fr
- Q Agarose gel electrophoresis O a base pairs
- Q MXXXTINE Diology ou a hidden heterozygote A PCR ana scientists load a Molecular Weight ma It ensures that no empty slots are left
- Q What is the size of the DNA band indicated with the blue star on th a 700 1 Size bp 1013 900 800 700 600 500 400 300 311 200...
- Q erall a molecule of DNA car ect one Truc
- Q Homer and his Little League team The Bernstein Bears play against the opposing team The Babysitters Club Unfortunately The Bernstein Bears lost the game Homer blames it on the weather...
- Q Which of the following is true about Alu Oit codes for proteins it reproduces itself O it inserts itself in the same location it originates found in fish genome Question...
- Q 8 Explain what an anticodon is by giving an example
- Q 2 What are the two categories of nitrogenous bases Put each base into the correct category by naming and drawing the molecules
- Q Itranscript Definition of Virulence Factors Please choose the best definition of virulence factors Multiple Choice O factors that enable a microorganism to be resistant to antimicrobial medica O characteristics of...
- Q 4 S Book Itranscript Colonization Infection and Disease Please match the term to the statement that most a of colonization infection and disease
- Q Concentration Electrolytes Solvent Solubility Alloy Nan Electrolytes Saturation Solution ionization unsaturated Solution Dissociation Solution 1 A solid plus a solid is called a b alloy c solvent 2 When making...
- Q 3 If the student is heterozygous how many bands will they see in the lanes for the blue and brown allele samples circle one Brown sample 0 Blue sample 0...
- Q Question 8 Points 2 How are minor parties discriminated against in the American electoral system O Voters never cast ballots for minor party candidates Minor party candidates do not appear...
- Q Question 5 Points 2 Which of these choices is NOT a major component of the two major political parties in the United States O The party organization including its leaders...
- Q Question 7 Points 1 Which is the only American political party to rise up from third or minor party to major party status O The Democratic Party O The Democratic...
- Q Jack o Frost Epis esis 1 YouTube Untitled C H O N
- Q Identify the heat source and type of heat transfer that causes it to melt Conduction convection or radiation Tell about the change in particle movement and arrangement Add more heat...
- Q You want to search for latent prints on a Styrofoam cup What type of fingerprint processing will you use O Ninhydrin Super glue Cyanoacrylate O Amido Black 4 points Black...
- Q Which passage from the Article best supports the idea that LeBron James I Promise School might help kids outside of Akron Ohio A At the school s opening a crowd...
- Q A population of panthers lives in a mountain ecosystem Over time the construction of highways and buildings is expected to reduce the size of the panthers habitat Which of the...
- Q NAME Compin Castaneda Worksheet 26 Protein Synthesis PART B Answer the following 1 Complete the table CODON PART A Match each term with the correct description by writing the letters...
- Q Biohazardous Waste includes Select one O Body fluids and body parts O Blood and blood products Animal wastes All answers are correct
- Q Factors affecting the performance of the glove in a specific case include Select one O Material thickness size and location of the lab O Material thickness chemical resistance and atmospheric...
- Q is any substance which speeds up the rate of a chemical reaction are considered both proteins and organic catalysts 1 A 2 All 3 To do its job an enzyme...
- Q 7 An insertion or deletion can result in a frameshift mutation To demonstrate this complete the following Note You will need a codon chart DNA mRNA Amino Acids DNA mRNA...
- Q Yeast is secreting CO2 causing bubbles in the dough Bacteria is eating up some of the gluten Bacteria secreting lactic acid is breaking up the gluten Yeast is secreting alcohol...
- Q Where can you find more information on how FIU manages hazardous chemical waste O Emergency Management Plan Bloodborne Pathogen Exposure Plan Hazardous Waste Management Plan
- Q The SARA Act amended CERCLA to include more Select all that apply O Insurance coverage O Ecological surveys Addition of more hazardous waste sites Citizen participation Stato involvement
- Q EH S provides a general hazardous awareness training or lab safety training online Who is responsible to provide lab specific hazard awareness training for all lab personnel Select one O...
- Q How long must the FIU Hazardous Waste Pickup Forms signed by the Waste Coordinator be maintained by the department PI or Laboratory Manager and be immediately available to University State...
- Q Containers of hazardous waste may be stored inside laboratory fume hoods when Select one Containers are inside a chemically compatible secondary containment of appropriate size O When the hood does...
- Q Broken glass disposable gloves used absorbent and other contaminated cleanup supplies from a hazardous spill must be Select one Placed in a plastic bag and put in the lab waste...
- Q Hazardous wastes are classified into two categories Select one O Listed Industrial O Industrial Environmental Charact
- Q Full Clean glass waste containers blue boxes are disposed by placing them into the waste dumpster regular trash by Select one O Laboratory personnel who generated the waste O An...
- Q Persons preparing and signing the Pick up Request Form are required to take the following training Select one O Hazard Communication HAZCOM O None are correct All are correct except...
- Q Cryogenic gases should be stored or used in O Confined spaces None of the answers are correct A well ventilated area Spaces with poor ventilation
- Q The following information must be stamped on the cylinder O DOT specification and serial number DOT specification O Barcode Serial number
- Q When must you separate cylinders Select ALL that apply When they are different colors When they are flammable and oxidizers O When they are new When they are full or...
- Q Once you are done with a gas cylinder you should O Take it to a dumpster for disposal O Leave it
- Q Which carbon on the deoxyribose sugar connects to the phosphate group 41116 HO P O phosphate Carbon 1 Carbon 2 Carbon 3 O Carbon Carbon S N OH H deoxyribose...
- Q Consider the reaction A B C D Under standard conditions at equiliubrium the concentrations of the compounds are A 0 1 M B 0 1 M C 1 9 M...
- Q QUESTION 6 G alpha is not only an activator of Adenylate cyclase but it is a GTPase How does mutation in G alpha th GTPase activity affect liver cell responses...
- Q biology II You are a researcher studying the
- Q Liver cells respond to epinephrine by O Producing ATP Increasing the rate of glycogen synthesis Breaking down glycogen Secreting the hormone glucagon which makes you feel hungry
- Q What is the first step in amending the constitution O Both houses of Congress must approve to make it a formal process O It must be ratified by the states...
- Q 3 What is the sequence of DNA that is complementary to the coding sequence of DNA given below coding DNA complementary DNA ATTACGATCTGCACAAGATCC
- Q Imagine you walk into lab after spring break and your TA hands you a beaker containing a solution of A B and C in water represented by the equilibrium shown...
- Q Archeological evidence suggests that Neanderthals may have been aware of the medicinal properties of plants over 60 000 years ago Imagine you are a modern day ethnobotanist and have identified...
- Q Which of the following is an advantage of multicellularity O Greater mobility Increased stability O Shorter generation times Easier to absorb nutrients
- Q 8 One difference between a postmortem injury and per mortem injury is O Postmortem injuries have sharp jagged edges with hinging Only postmortem injuries have no sign of healing O...
- Q individuals O There is more genetic variation within an ancestral group than between different ancestral groups ancestry as a category to classify There is more genetic variation between different ancestral...
- Q 5 Which type of skeletal injury could be from a homicide antemortem Operimortem O postmortem 6 Injury on skeleton made from carnivores and scavengers gnawing on bone O antemortem Operimortem...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!