Biology question and answers for November 19, 2023
- Q In the example below the DNA sequence is transcribed into mRNA which gets translated into protein DNA sequence mRNA sequence Amino acids Met Leu Leu Val Phe STOP STOP MEANS...
- Q In the famous Hershey and Chase experiment 35S ended up in the supernatant after centrifugation What were they able to conclude from this result This means that the supernatant contains...
- Q According to the table below which of these two organisms are the most closely related Species Human Horse Gorilla Chimpanzee Zebra Region of Amino Acid Sequence LYS GLU HIS ILE...
- Q Heat killed Pneumococcus S cell extract that has been treated with RNase i e ribonuclease cells into S cells The conclusion that can be drawn from this is that Does...
- Q In the famous Hershey and Chase experiment 32p was in the pellet after centrifugation What were they able to conclude from this result This means that the pellet contains the...
- Q What does the term phenotype mean Select one The detectable physical and physiological traits of an individual organism Ob The complete sequence of DNA in all of an individual s...
- Q Answer Bank this structure needs a protonated cytosine for stability and thus is most stable at low pH I four stranded right handed helix formed by a DNA segment containing...
- Q 6 BamHI and HindIII cuts plasmid pAPBIO2022 in two locations Using this information construct a restriction map of pAPBIO2022 Enzymes BamHI HindIII BamHI HindIII Digestion Fragment Size kbp 30 kb...
- Q Bacteria and other microbes can be used to clean up an oil spill by breaking down oil into carbon dioxide and water Two samples isolated from the Deepwater Horizon leak...
- Q How many hydrogen bonds exist between this DNA strand and its complementary strand 5 GGGAGCC 3 21
- Q 5 3 List what each of the following symbols stands for in human pedigree 5pts a b C d O dado 6 60001 00 of
- Q D release factors amino acids O ribosomes codons O initiation factors Question 3 Which of the following is true A amino acids must be attached to the 3 hydroxyl group...
- Q D O L shape O ALL OF THESE O NONE OF THESE O cloverleaf O twisted triple helix Question 9 Which of the following features are NOT common to all...
- Q 6 In starfish pink body color P is dominant to orange p and thick eyebrows T are dominant over thin t ones Patrick who is heterozygous for body color but...
- Q Two true breeding pea plants are crossed one has purple flowers and green seeds and the other has white flowers and yellow seeds The F1 progeny are selfed to get...
- Q Which of the following merodiploids would be constitutive for lacZ expression in the absence of lactose lacl laco lacz lacl laco lacz lacl laco lacz lacl laco lacz Olacl lacoc...
- Q P1 P wild type x sepia eye se If the F1 result is 15 wild type females and 10 wild type males what inference can be made about which trait...
- Q 10 Why do offspring want more parental care than parents are willing to provide What is this conflict called
- Q 01 22 dj 14 Which type of cells in our body would have a high mutation rate and why Lab 10
- Q Morgan referred to males as hemizygous because the carry the genes A autosomes C females B X chromosome doesn t D Y chromosome doesn t
- Q Pre orRNA processed into mature crRNA Phage infects the bacterial cell with its DNA Phage DNA incorporated as a new spacer into CRISPR crRNA Cas machinery cuts complementary target DNA...
- Q You may need more than one Punnett square to answer the question You will provide completed Punnett square s and your answers to the questions You will receive 1 point...
- Q Nearly all human trai mathematics and mo ways to calculate the square This is a simp in children given the genotypes occurring
- Q In the lab you use a special balloon that is permeable to water but not sucrose to make an artificial cell The balloon is filled with a solution of 20...
- Q early all human traits even many diseas athematics and modeling these inherita ays to calculate the mathematical proba uare This is a simple way of discoverin ccur in children given...
- Q Which of the following is an advantage of sexual reproduction over asexual reproduction OA The rate of reproduction is slower OB Offspring are genetically different from their parents OC There...
- Q Chromatin remodelling regulate gene transcription 3 How are non coding regions of a gene involved in its transcription
- Q 2 How does chromatin remodelling regulate gene transcription
- Q In protein translation one three two four mRNA nucleotide s correspond to one amino acid in the polypeptide sequence
- Q The initiator tRNA interacts with the signal sequence Shine Dalgarno sequence anticodon start codon AUG or rarely GUG which always codes for methionine
- Q customized If a mutation occurs in which a purine is replaced by another purine it is referred to as a DNA STI TURE AND FU transition substitution transversion substitution mismatch...
- Q What is replicated during the synthesis phase of the cell cycle O ATP DNA O daughter cells O messenger RNA
- Q Directions Select the correct entries in the table The nucleotide sequences of four species are shown in the table below Select the nucleotide sequences of the two species that are...
- Q GGCG is a nonessential eukaryotic promoter sequence that binds cellular factors to increase the efficiency of transcription anc GENES AND PROTEINS cust O FACT O CAAT box O holoenzyme O...
- Q Watch The Gene An Intimate History Part 2 This is the second part of the documentary you watched a few weeks ago This continues the story of the history of...
- Q A child has type O blood Which of the following couples could be the child s parents Couple Mother s Type Father s Type 1 2 3 O A couple...
- Q Directions Drag the correct tile to the empty space in the Punnett square The Punnett square below represents a dihybrid cross of two rose bushes In this species red petals...
- Q A student crosses two homozygous plants one with green pods and the other with yellow pods If yellow is dominant over green what phenotypic results will the student find in...
- Q An organism s genotype describes its specific combination of alleles For example an Aa genotype is heterozygous for the A allele An organism s phenotype describes a visible trait such...
- Q Errors that are made during DNA replication may result in O A mutations OB O C radioactive decay identical twins OD a viral infection
- Q A codon is a set of three nucleotides that correspond to a specific amino acid The table below shows various DNA codons and their corresponding amino acids 4 Amino Acid...
- Q Directions Select each correct answer Which of the following events can result in inheritable genetic variations in organisms genetic recombination during meiosis occurrence of viable errors during DNA replication mutation...
- Q 57 An octapeptide was determined to have the following amino acid composition Lys 2 Phe 2 Gly 1 His 1 Leu 1 Met 1 The native peptide was run through...
- Q Activity Complete the following 1 In the diagram below label A the DEOXYRIBOSE SUGAR MOLECULE WITH A S B the PHOSPHATE GROUP with a P C the NITROGENOUS BASES with...
- Q Genetic Term Allele Chromosome Dominant trait Y F1 generation F2 generation Gene Genotype Heterozygous Meaning
- Q Drag and drop the components of mRNA processing to match with their description Modification added to the 5 end of pre mRNAs to protect mRNA from degradation and assist translation...
- Q 7 In what process is mRNA synthesized Mitosis Transcription DNA Replica
- Q KEY Unaffected male Unaffected female Affected male Affected female 25 1 11 1 H 2 3 The pedigree shown represents the inheritance pattern of a gene disorder caused by a...
- Q amalas group R H carboxyl group General structure of an a amino acid carbohydrates The diagram below shows the general structure of an amino acid Which type of molecule is...
- Q x A translation x 4x The diagram shows an unpredicted change in the genetic material of two chromosomes The change in DNA is called a B C D transcription mutation...
- Q Which two selections correctly pair a term with an example A Phenotype short fur B Trait heterozygous C Allele fur length D Genotype Ff
- Q r r Rr Rr Rr Rr minance R When red carnations are crossed with white carnations the resulting flowers are pink Pink carnations are an example of what type of...
- Q Why is greater genetic diversity important for a species species is more likely to survive disasters there will be less competition with other species the population of the specie will...
- Q Hitchhiker s thumb H is dominant to no hitchhiker s thumb h A woman who does not have hitchhiker s thumb marries a man who is heterozygous for hitchhiker s...
- Q Billy and Johnny are brothers but they do not look alike Which of the following factors contributed to this genetic variation asexual reproduction and binary fission cytokinesis and cloning crossing...
- Q Step No 1 Step No 2 Step No 4 Step No 5 Step No 6 Question 5 6 Choose Choose That is the animal cell That is the bacterial cell...
- Q 1 Think about how the trp operon of E coli is regulated by attenuation a When tryptophan is scarce what is the role of the Ribosome and tRNAs charged with...
- Q 6 Translate the mRNA strand into the corresponding amino acids using the chart provided 20 pts MMMARNANNA UC G G C C CC G First base U C U UUU...
- Q The first two questions refer to the following data A series of 5 auxotrophic the synthesis of a product called pr7 These are used to determine the biochemical pathway by...
- Q 5 Khorana devised a method of generating artificial mRNA molecules that could be translated to test the makeup of the genetic code If the dinucleotide sequence A C n where...
- Q QUESTION 8 Imagine that a chemical was released Place the following steps in order as th 1 Protein translation 2 Binding of the signalling chemic 3 Transcription factor activation 4...
- Q anscription factor hancer TION 2 c operon which of the following best describes w e absence of lactose the active repressor binds t le lac operon the genr
- Q 1 If the mRNA produced by a certain bacterial gene has 50 G 10 U 28 A and 12 C nucleotides what proportion of the corresponding sense strand nucleotide bases...
- Q 19 The largest component of a chromosome by dry weight is a histone protein b DNA c RNA d non histone protein 20 Where would you find the molecule diagrammed...
- Q 13 If an artificial mRNA is synthesized with the nucleotide sequence 5 ACCC 3 repeated over and over again in tandem and then translated artificially in vitro how many different...
- Q 5 a True b False One factor influencing the binding of DNA to nucleosomes is the high proportion of amino acids that carry a positive charge in histones This gives...
- Q The next three questions refer to events related to the diagram at the right The Exit site E is not shown 10 The gray arrow is pointing to which end...
- Q 8 There is no direct correlation between the amount of DNA and the developmental complexity of a given species because there is a lot of heterogeneity in eukaryotic genome makeup...
- Q 3 The wobble hypothesis applies to the base located at the a 5 end of the codon b 3 end of he codon c 3 end of the anticodon d...
- Q 6 a True b False Euploidy is having a chromosome number that is not an exact multiple of the haploid number as illustrated by the human condition Down Syndrome 7...
- Q Give the standard notation for a strand of DNA that is complementary to 5 CGGTA 3 AT FA Y BIU 000 T Y DO
- Q If a hypothetical antibiotic drug inhibited amino acids from binding to RNA which type of RNA molecule would lose its function mRNA rRNA tRNA None of the above theloww
- Q Quiz Instruction D Question 10 In transcription
- Q CONCLUSIONS 1 Which type of mutation is responsible for new variations alleles of a trait 2 Which type of mutation results in abnormal amino acid sequence 3 Which type of...
- Q The template strand of a segment of double helical DNA contains the sequence 5 CTTAACACCCCTGACTTCGCGCCGTCG 3 What is the base sequence of the mRNA that can be transcribed from this...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!