The template strand of a segment of double helical DNA contains the sequence 5 CTTAACACCCCTGACTTCGCGCCGTCG...

60.1K

Verified Solution

Question

Biology

image

The template strand of a segment of double helical DNA contains the sequence 5 CTTAACACCCCTGACTTCGCGCCGTCG 3 What is the base sequence of the mRNA that can be transcribed from this strand 5 What amino acid sequence could be coded by this mRNA starting from the 5 end Enter the sequence using the one lett amino acid codes amino acid sequence If the complementary nontemplate strand of this DNA sequence were transcribed and translated would the resulting amino acid sequence be the same Why or why not No the complementary antiparallel strands in double helical DNA do not have the same base sequence in the 5 3 direction Yes the complementary antiparallel strands in double helical DNA have the same base sequence in the 5 3 direction Yes both an amino acid codon and its complement code for the same amino acid No the nontemplate strand contains a stop codon resulting in the production of a truncated peptide

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students