Biology question and answers for August 12, 2023
- Q Describe why pH has an effect on the tenderness of meat.
- Q Given the sequencebelow5’AACTTCGGCTTAAATGGAGGCCAT’What is the complementary DNA strand?What would the mRNA strand look like?What would the protein look like?Create a point mutation in the DNA and then give themRNA and...
- Q Summarise the three main postmortem stages involved in theconversion of muscle to meat.
- Q What is a reporter gene construct? b. Where did the reportergene come from? What is its normal biological function? c. How wasthe expression of the reporter gene controlled? d. What...
- Q List and describe the early stages of animal development,beginning with fertilization. Then describe two similarities andtwo differences between early plant and animal development.
- Q This week we will address health assessment (ch 7) andtechnology (ch 8) as part of the policy process we discussed week 1(problem definition, see page 7-8). The readings are reallyimportant...
- Q What kind of phylum and class does common Juniper belongs to?
- Q Describe the key processes in urine formation in a mammaliannephron, beginning with the glomerulus and ending with theexcretion of urine from the collecting duct into the renalpelvis.
- Q Chlor?uazuron, Oxymatrine, and Spinosad (insecticides) weredifferent in their activity for inhibition of AChE and ATPase inhoney bees, what is the reason? Why is the rate of inhibitiondifferent in different honey...
- Q Has WHO learned it’s lesson from Ebola in handling COVID-19? Whyor why not?
- Q Discuss the significance of antigenic drift andantigenic shift
- Q Compare and contrast the roles of GNRH, LH, FSH and steroidhormones in the regulation of gametogenesis in human males andfemales.
- Q Compare the osmoregulatory challenges faced by saltwater andfreshwater fish, and the ways in which their bodies achievehomeostasis with regard to osmoregulation.
- Q Describe intracellular trafficking of CI-M6PR, with names ofspecific molecules involved in the process, and its role inmechanism underlying I-cell disease.
- Q How many NADH molecules are generated by the complete breakdownof one molecule of glucose through glycolysis, Reaction zero(Pyruvate dehydrogenase complex) and the Kreb's cycle?a) 5b) 8c)10d)12Which of the following is...
- Q Cells and VirusesObserve and draw the following cells.  Plant cell (slide) – Note cell wall,chloroplastWhat does this tell you about the functions of this cell?Pancreatic cell (slide) – Note large amounts...
- Q You have reviewed bacteria and how they cause disease. In somecases the spread of bacterial infections is actually caused byhuman error. In the Microbial Pie case, you saw how improperlyprepared...
- Q discuss the process and principle involved forscreening/selection of hosts (last stage of cloning) containing theintended recombinant plasmid.
- Q By and large, the features observed in animals, plants, fungi,and biological organisms, in particular, are representative oftheir function and shaped by natural selection in the context oftheir environment. When we,...
- Q Q6. Imagine that the population of aquatic insects doubled in acertain pondweed area. How would the net primary productivitychange from an area where the aquatic insect population were at thenormal...
- Q The organelle known as the powerhouse (provides energymolecules) of the cell is theQuestion 1 options:vacuolenucleusmitochondrionribosomeThe organelle known as the control centre (brain, library) ofthe cell is theQuestion 2 options:endoplasmic reticulummitochondrionnucleuschloroplastMolecules...
- Q Can organisms use both mechanisms of ATP? (OxidativePhosphorylation and substrate-level phosphorylation)
- Q a) What is the molecule responsible for the release of transportvesicles and describe its function in the endocytosis of LDL viaLDL receptors.b) Comment on how inhibition of the molecule identified...
- Q what experiments could be done to learn more about quorum sensingin myxoccus xanthus??(microbiology)
- Q 1. Antibiotic EvaluationThe following set of data was taken from tests of antibiotics ontwo organisms isolated from the lungs of a patient with CysticFibrosis. These evaluations were carried out using...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!