Biology question and answers for May 13, 2024
- Q Question 17 Points 3 Which production system is mentioned in this graphical representation Production of large number of items The assembly line was then devised by the manufacturers O Division...
- Q Question 18 Points 1 Who is considered the founder of modern economics The Physiocrats Thomas Malthus David Ricardo O Adam Smith
- Q Offend fork Efst k Alla fing st
- Q In his essay Common Sense Paine fears that they might be in danger of being rule by a ruffian in case they don t act then Whom does the word...
- Q homologous chromosome pair maternal a paternal 1 DNA rep 2 STZAAN 3 Question 2 When does the transition from stage 2 to stage 3 occur A Mitosis B Meiosis I...
- Q Question 10 of 10 Which two examples would likely result in a decrease in biodiversity A A sudden shift in conditions that a species lacks adaptations to survive B The...
- Q 4 Examine the following sequence Note that only one of the complementary strands is shown You do not have to write in the complementary strand I 5 atgcacgcag ttttacttgc ttcttcaaga...
- Q d Using the previously made stocks on the previous page of 5 00M Tris 3 00M MgCl and 0 500M DTT how would you make 50 0mLs of 10x Ligation...
- Q a If positive control is homozygous recessive would you be able to determine if restriction digestion was effective b Forward and reverse primers complementary would anneal rather than anneal to...
- Q 5 4 points You have 5 x107 cells mL in a volume of 2 mLs a How many cell culture flasks can you seed at a density of 1 x...
- Q 8 A In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 plate LB LB AMP LB AMP ARA...
- Q 9 Why are positive and negative controls important in the western blot explain how those results can affect the Ponceau stain and the Western blot data When and why would...
- Q 11 What was the purpose of SDS and NaOH in the plasmid isolation proctocol Why was ethanol Isopropyl alcohol used in the isolation protocol For the plasmid isolation protocol why...
- Q B In performing the transformation experiment with rpARA plasmid give two reasons why the following results might have happened 4 Experiment 1 Plate B LB AMP B AMP ARA Explanation...
- Q 10 Why do some Bacteria stain gram positive versus gram negative What structural components are different in bacteria that result in different colored bacteria in the gram stain When and...
- Q 6 2 points A procedure calls for 10ng of stock solution is 1 g DNA L How much stock do you need if your reaction mixture will be a total...
- Q cells mL You dilute the broth by removing 1mL and adding 4mL of sterile medium to give you dilution tube 1 of bacterial cells You remove 1mL from this first...
- Q b How would you make 500 0mLs of 3 00M MgCl mw 95 21 g mol Explain in words 1
- Q Order the steps in breaking down a fatty acid 3 poir Dragged and dropped options will be automatically saved For keyboard navigation SHOW MOR III III III E Linkage to...
- Q The degradation of amino acids fatty acids and glucose all require the use of this same pathway Selected answer will be automatically saved For keyboard navigation press up down arrow...
- Q What actually dictates the 5 3 direction of DNA replication O Okazaki fragments are not sterically hindered by 2 OH found in ribonucleotides making the 5 to 3 synthesis possible...
- Q Choose the enzyme that synthesizes an RNA strand consisting of 10 nucleotides that is complementary to one of the template DNA strands endonuclease primase topoisomerase O helicase O polymerase
- Q Question 1 of 10 Which sentence describes an example of a spontaneous mutation A Radiation causes chemical bonds to form between cytosines O B Compounds insert themselves into the double...
- Q 5 Calculate the nucleic acid concentration in g mL from the following information 4pts DNA A reading at 260 nm 0 35 a b C d RNA A reading at...
- Q dicate which lymphocyte population you would expect to proliferate in each case Scenario I Ecenario II You decide to co culture lymphocytes from the strains listed in the table in...
- Q If an antigen that produces immunity on a pathogen is a carbohydrate would it be possible to create and use a DNA vaccine to induce long term immunity against that...
- Q Proteins 7MRNA7 Enzymes Amino acid metabolism Metabolism Lipid metabolism Carbohydrate metabolism
- Q Below is a graphic that shows ways in which a mutation may influence the sequence of nucleotides in a gene and the structure of an associated protein Choose the correct...
- Q pedigree ng pedigree plete the Aa paragraph OOC O 100 500 a At the top of the pedigree is the grandfather Based on the inheritance pattern of his offspring and...
- Q Different methods of radiation Keyboard Navigable Alternate Version Complete the following paragraph concerning the different methods of radiation a Click to select cancer symptoms another type of cancer treatment uses...
- Q Complete the sentences Each blank is worth 1 point Word bank to choose from disulfide bonds hydrogen bonds ionic bonds ion dipole interactions van der Waals interactions There are two...
- Q The mutant coding DNA strand 5 GGCCATGACAGAGGAGAAAAAGTTATTGCT 3 Write the mRNA sequence for this patient Write it 5 to 3 but only include the letters in the sequence ex ACGG...
- Q The type of photophosphoryla tion that is only involved in making energy not food is called A Chemiosmosis B linear photophosphorylation C cyclic photophosphorylation D basic photophosphorylation
- Q fish appeared in the Silurian reached their greatest diversity in the Devonian a time known as the Age of Fishes and became extinct at the end of the Devonian They...
- Q 33 Did they have gills 34 Did they have scales 35 Give the age period name and dates of the earliest fish from these two references 36 Where did Astraspis...
- Q Latimeria a modern sarcopterygian coelacanth living near Madagascar Note the similarity of the tail to that of Eusthenopteron fossils in the previous figure The tail is very different from that...
- Q John Wesley Dobbs Have you crossed John Wesley Dobbs Avenue on your way to class or heading for a friend s dorm But who was john Wesley Dobbs Dobbs grew...
- Q What are the proper triple examples for the abiotic components a Plants animals and nutrients O b Fungi water and soil O c Animals parasites and bacteria d Viruses nutrients...
- Q The analogues in an analogical argument are the things to which entities in a conclusion are being compared True False
- Q Analogical arguments are arguments based on comparison True False
- Q Which of the following options best describes this sentence Life is like a box of chocolates An argumentative analogy Not an analogy An illustrative analogy
- Q The following is an analogy A rose is a rose is a rose True False
- Q Select which of the four standard categorical forms best describes the following statement All dogs are not quadripeds Universal Affirmative UA Universal Negative UN Particular Negative PN Particular Affirmative PA
- Q Which of the following options best describes the following statement Either you are going to win or you are going to lose It is a disjunction It is a conjunction...
- Q at which stage of Meiosis do daughter cells become haploid Following Prophase of Meiosis II O Following telophase of Meiosis II O Following anaphase of Meiosis II Following anaphase of...
- Q A cell has completed G2 and moved on to M phase A spindle fiber has not properly connected to a kinetochore Which of the following will happen first in a...
- Q Paramecium aurelia is an organism that can reproduce both sexually and asexually It does not have cell walls or tissues To which kingdom does it belong O A Animalia OB...
- Q 6 Describe what happens during an action potential hint a labelled diagram may be useful
- Q 1 How did the leech get anesthetized
- Q b How would blocking calcium not allow muscles to contract and paralyze the fish
- Q 8 When probing the leech which section of the neuron responded to the brush ex 1 mark central or outside neurons
- Q 6 What are the 3 different tools used to stimulate the leech s skin
- Q a What protein does calcium bind to on the actin filament that initiates the sliding filament model ex muscle contraction
- Q 3 What neurotransmitter will not be released if calcium channels are blocked 1 mark
- Q b What halts the gliding motion of the myofilaments
- Q 4 The muscle contracts when thin and thick filaments slide past each other What is this called 1 mark
- Q a Explain the role of calcium in signaling an impulse to the motor neuron
- Q 1 Draw the synapse and identify the main parts of a pre synaptic cleft and a post synaptic 5 marks cleft include vesicles neurotransmitters receptor proteins or channels
- Q 5 How is an electrical synapse different from a chemical synapse
- Q 1 Muscles are striated What are the thick and thin filaments called that make the muscle 2 marks striated Identify which is thick and which is thin
- Q 3 What are neurotransmitters Include an example
- Q 4 What is an electrical synapse
- Q 4 What encases the leech s nerve cord
- Q 3 In step 5 of the procedure why can you not see the nervous system even though the other organ systems are present 1 mark
- Q 2 What part of the nerve cell is on the pre synaptic side hint the neuron that transmits the signal to the dendrite 1 mark
- Q 2 Inside the leech what type of blood is visible
- Q Marsupial mammals Love the one you re with TO According to the phylogeny the bilby is most closely related to the devil
- Q 1 Biology scientific study of life CELL SYSTEM OF ORGANS ORGAN TISSUE CELL ORGANELLES MOLECULE ATOM ORGANISM BOMA POPULATION HERE BIOCENOSES ECOSYSTEM 2 Science Any method of learning about the...
- Q Supporting cell Olfactory bulb Olfactory gland Olfactory cilia Olfactory epithelium Olfactory stem cell Olfactory sensory neuron Mitral cell Olfactory tract 00 141 Route of inhaled air containing odor molecules Pearson...
- Q Match the following sensory receptors to the stimuli they detect Match the words in the left column to the appropriate blanks in the sentences on the right Make certain each...
- Q Excessive UV radiation causes a healthy tan along with many skin and immune system benefits only causes tissue damage and skin cancer in people with fair skin can cause tissue...
- Q Match the tissue type with its function protection from wear and tear supports and binds other tissues can act as a water reservoir filtration and exchange of substances via diffusion...
- Q regions called median sagittal frontal transverse Question 3 2 points Listen Homeostasis gh the body dividing it into anterior and posterior is unimportant for our overall health helps keep our...
- Q dy cavity houses the viscera whereas the ventral body cavity hoses the nervous system True False Question 5 2 points Listen Which of the following is false regarding water It...
- Q The sodium ion concentration is higher inside the cell than outside and the potassium ion concentration is higher outside the cell than inside True False
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!