Biology question and answers for June 25, 2024
- Q What are determined in AD AS model Oreal GDP and nominal GDP the price level CPI and aggregate demand the price level CPI and aggregate supply real GDP and the...
- Q If the national incomes of our trading partners increase then our aggregate demand increases because net exports increase increases because consumption increases decreases because net exports decrease decreases because consumption...
- Q What is the cyclical unemployment George used to work in an automotive assembly plant He was laid off six months ago as the recession took place Kara voluntarily quit her...
- Q There will be unemployment in a labor market if there are perfectly flexible wages there is no minimum wage the current wage is above the equilibrium wage the current wage...
- Q During a recession both the equilibrium wage and the equilibrium level of employment are low Why Olower supply of workers higher demand for workers lower demand for workers higher supply...
- Q Opportunity cost is the combined value of all the alternatives not selected based on the intrinsic value of the good itself the value of the next best alternative which was...
- Q An increase in investment and government purchases can be expected to shift the aggregate demand curve to the left lead to movement up along the aggregate demand curve Olead to...
- Q Suppose the economy is experiencing deflation with very high unemployment when the target inflation is near 2 Which policy would the Fed central bank enact contractionary monetary policy by decreasing...
- Q H T H C OHA 1 6 0 CH 2 Ethanol 2 NAD 2 NADH 2 H Alcohol fermentation used by animal cells Ethanol fermentation generates ethanol 2 Pyruvic acid...
- Q Cellular respiration is carried out in the presence of oxygen aerobic conditions or the absence of oxygen anaerobic conditions Determine whether each event occurs under aerobic conditions anaerobic conditions or...
- Q Supercoil www Answer Bank protein chromatin DNA molecule chromosome
- Q Homologous chromosomes linked by a centromere have different parental origins Answer Bank Sister chromatids result of chromosome duplication may have different alleles
- Q Identify the cell cycle stage for each cell in the diagram Vy V K Answer Bank metaphase prophase interphase telophase anaphase
- Q Learning What are the functions of mitotic cell division replacement of cells asexual reproduction growth of multicellular organisms production of eggs or sperm
- Q Match each cell with its stage in the cell cycle Telophase and cytokinesis Anaphase Interphase Prophase Metaphase Answer Bank
- Q Label each phase of the cell cycle with the appropriate name or description phase of quiescence O S phase Answer Bank mitosis and cytokinesis U 14 last stage of interphase...
- Q Identify each stage of M phase AAAA V V V V DOS Answer Bank VVK 3 8
- Q The cell cycle is a repeating sequence of events that leads to the duplication and division of a cell Place the stages of the cell cycle in the order of...
- Q Arrange the amino acids coded for in the translation portion of the interactive in the correct order starting with the first amino acid at the top Start
- Q Complete the transcription of the RNA sequence using the DNA template DNA template ATC GAC De
- Q Macmillan Learn Transcription Answer Bank Translation
- Q Match each cellular component to a role in transcription or translation in eukaryotic cells protein complex that makes RNA polymers corresponding to a DNA template location where transcription occurs region...
- Q The codon table identifies the amino acid sequence be translated from a human mRNA sequence This chart can also be used to identify amino acid sequences for other organisms Select...
- Q ch amino acid in a protein is encoded by a group of three nucleotides known as a codon Use the codon table to match mRNA lons and the resulting amino...
- Q What is a conclusion that can be made based off of the data shown in the graph PERCENTAGES OF CODING DNA FOUND IN VARIOUS ORGANISMS Human Homo sapiens 2 Fruit...
- Q 1 Describe the purpose and goal of the Indian Removal Act 4 points
- Q 5 TRPV4 is a gene in cats that encodes for calcium permeable ion channels The Scottish Fold is a breed of cats that has a mutated dominant TRPV4 gene Mutations...
- Q 4 Transgenic Bt crops have been genetically modified to resist common herbicides have increased protein content produce an insecticide be tolerant of salt in the soil grow faster a b...
- Q 1 Before biopharming technology became available human proteins used in treatment of diseases were a b C d cadavers unavailable synthesized chemically free of contaminating factors harvested from slaughterhouses donated...
- Q The proofreading function of genomic DNA polymerase must be a function as the nucleotide addition function of DNA polymerase The enzymatic Time left 0 53 33 function of proofreading is...
- Q Which of the following are important in reducing the errors in DNA replication in eukaryotic organisms Select one O a proofreading activity of genomic DNA polymerase O b More than...
- Q 1 What is the name of the DNA polymerase in the method 1 pt 2 What is the scientific name of the bacterium that produces the enzyme Use proper nomenclature...
- Q 5 Select four cards to create a food chain starting with a producer Label the trophic level of each organism in your food chain as follows producer primary consumer secondary...
- Q Can you write a takehome message about what you learned about career service
- Q Can you write a takehome message about what you learned about career service
- Q Can you write a takehome message about career service
- Q Can you write a takehome message about career service
- Q Can you write a takehome message about career service
- Q Which choice best describes data from the table that support the team s conclusion Choose 1 answer B Adenine and xanthine were detected in both of the meteorite samples and...
- Q RNA 1 List the 3 stages of Transcription 3pts The 3 stages of transcription are initiation elongation and termination 2 Look at the strands from DNA question number 4 Copy...
- Q Predict percentage of offspring with flower colors in snapdragons In snapdragons there is one allele that produces red flowers and another allele that produces white flowers Neither allele is dominant...
- Q Which of the following is true about pasteurization Mark all that apply It renders food sterile It kills pathogens It reduces the number of spoilage causing microbes HTST pasteurization uses...
- Q Which antibiotic would the doctor NOT prescribe to a patient with an infection caused by the bacteria growing on this plate View Image Ciprofloxacin Rifampicin
- Q D Antibacterial soaps used in the lab contain some form of O Alkylating agents O Phenolics O Peroxygens Question 7 0
- Q What is the BSL for our Micro class answer A Select and what would it be for agents that cause hemorrhagic fever several bleeding organ failure and death answer B...
- Q Which process eliminates all vegetative cells endospores spores and viruses from culture liquid media in glass bottles O Disinfection O Antisepsis O Sterilization Sanitization Sanitization O Disinfection O Sterilization O...
- Q True False Question 6 2 points E Listen The Supreme Court ruled in Kane v Garcia Espitia that detainees who are representing themselves in a criminal trial must have access...
- Q In the reaction catalyzed by aconitase the conversion of citrate to isocitrate is inhibited by fluoroacetate Fluoroacetate is used as a pesticide Why is this an effective pesticide O It...
- Q QUESTION 39 Plants that show a pattern of stomatal opening and closing that is the reverse of C3 plants are called O C4 Temperate O CAM O Calvin cycle QUESTION...
- Q If you tagged organic carbon inside a chloroplast with a fluorescent label the location most likely to have a high concentration of labeled carbon would be in the O Stroma...
- Q QUESTION 33 What stage of cellular respiration can occur in human cells with or without oxygen present O The Krebs cycle O Glycolysis O The electron transport chain O Pyruvate...
- Q Organisms that can manufacture their own chemical energy are called O autotrophs O heterotrophs O oligotrophs O chemotrophs QUESTION 32 In animals that take in oxygen from their environment glucose...
- Q Mendel used the garden Olily carrot onion pea plant for his studies on inheritance QUESTION 48 In modern terminology Mendel s heredity factors are called O DNA O chromosomes O...
- Q The division of a O cell wall develops cracks around the equator of the cell O chromosomes are pulled toward the ends of the cell O actin and microtubules constrict...
- Q Homologous chromosomes pair along their length during prophase I of meiosis While two homologues are paired genetic exchange may occur between them in a process called O syngamy O synapsis...
- Q Based on hierarchical levels of biological organization which of these choices represents the broadest level O Endocrine system O3 toed sloths O School of piranhas O Amazon Basin O Jaguars...
- Q QUESTION 49 Traits that are controlled by genes located on the X chromosome are said to be O autosomal O gametal O sex linked Opleiotropic QUESTION 50 The lagging strand...
- Q QUESTION 9 Sugars dissolve well in water because of water s O polarity O ionic bonds O hydrophobic exclusion O cohesiveness QUESTION 10 Atomic nuclei contain protons and O moles...
- Q A cell biologist produces a karyotype of mouse somatic cells arrested in mitosis She sees 40 chromosomes which is completely normal for mice Based on this information what is the...
- Q QUESTION 7 The number of protons in a given atom is equal to its O neutron number O mass O atomic number O molecular number QUESTION 8 Atoms containing a...
- Q QUESTION 5 A suggested explanation that might be true and is subject to testing by further observations is a n O hypothesis O experiment O scientific principle O generality O...
- Q QUESTION 3 After Darwin concluded his voyage on the Beagle he proposed that the process of natural selection was a mechanism for O overpopulation of finches on the Galapagos Islands...
- Q DNA Rep Directions Drag the cards below to fill in the blanks in the paragraph about DNA replication lagging strand helicase There are many strand while I The 1 an...
- Q DNA 1 Develop 3 individual DNA strands that includes all 4 bases and is 50 bases long include directionality 4pts 3 Strand 1 5 ATCGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCA Strand 2 5 TACGTACGATCGTAGCATCGTACGATCGTAGCATCGTACGATCGTAGCT 3...
- Q A new disease wiped out the majority of a population The only individuals that survived were homozygous for a recessive allele that encodes for a form of an enzyme that...
- Q 4 Process your RNA strand by removing 3 introns totaling 30bp joining the exons and adding a Poly A tail 10pts 5 AUCGUACGAUCGUAGCAUCGUACGAUCGUAGCAUCGUACGAUCGUACAU 3
- Q A bottleneck event can lead to natural selection mutation genetic drift migration of new alleles into the population
- Q Which of the following is an example of the founder effect A tornado destroys all but 15 individuals in a toad population A group of 15 male and female birds...
- Q A large population of laboratory animals has been allowed to breed randomly for a number of generations After several generations 25 of the animals display a recessive trait aa the...
- Q You are working at a medical clinic and notice that 4 of individuals in the population have a debilitating disease After doing a pedigree analysis you determine it is an...
- Q In the formula for determining a populations genotype frequencies the pq in the term 2pq is necessary because heterozygotes have two different alleles heterozygotes can come about in two ways...
- Q Genetic variation is created by the direct action of natural selection arises in response to changes in the environment tends to be reduced when diploid organisms produce gametes must be...
- Q 12 Prepare 200 mL of 20 Sodium Dodecyl Sulfate SDS 13 Prepare 500 mL of 70 Ethanol 14 Prepare 500 mL of Plant DNA extraction Buffer 200mM Tris buffer 250...
- Q A heterotroph is an organism that obtains it energy from consuming another organisms or dead organisms O False QUESTION 3 Which of the following is undergoing active cell respiration to...
- Q QUESTION 5 Place the steps of mitosis in chronological order Metaphase Prophase Telophase Anaphase QUESTION 6 Match the stage of mitosis with the correct description Metaphase Prophase Anaphase Telophase A...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!