Biology question and answers for June 24, 2024
- Q a protozoa b Protista c prokaryote d eukaryote e Gymnospermae f fungi g domain h Bacteria Open with Google Docs 1 Archaea j Eukarya Definition 1 kingdom of single celled...
- Q Protista prokaryote eukaryote Gymnospermae fungi domain Bacteria Archaea
- Q A n eukaryote is a single celled organism that does not contain membrane bound organelles O O False True
- Q Plants are examples of heterotrophs True O False
- Q Phylum is the highest taxonomic level above kingdom O True False
- Q A n dichotomous key is a diagram depicting the evolutionary relationships between different species or groups O True O False
- Q A n genus is a taxonomic level consisting of a group of similar species O True False 1 poin
- Q Species are defined based on their physical appearance and a set of physical characteristics called biodiversity O True O False
- Q A scientist specializing in the study of plants is a n botanist True O False
- Q The variety and number of life forms on Earth is called hybridization O True O False
- Q Can you make two questions about patents
- Q Can you make two questions about patents
- Q What organism is shown in this figure Olichen mould mushroom O yeast green algae hyphae
- Q Which term describes a round bacterial cell O pathogen O spirillum bacillus COCCUS
- Q Which term describes an organism that cannot survive in the presence of oxygen obligate aerobe O obligate anaerobe O pathogen facultative aerobe 1F
- Q Which statement is true about all members of Domain Eubacteria and Domain Archaea 1 point O They are multicellular organisms prokaryotes and contain membrane bound organelles They are multicellular organisms...
- Q Which term describes a small loop of DNA often found in prokaryotic cells that usually contains a small number of genes plasmid bacillus COCCUS capsule
- Q Which statement s is are true about prokaryotes The total mass of prokaryotes exceeds that of animals and possible all plant life on Earth More than 100 trillion bacteria live...
- Q Which animal is classified in the Arthropoda phylum pinworms earthworms snails insects
- Q Which term describes a form of asexual reproduction that involves the division of one parent cell into two genetically identical daughter cells Otransformation conjugation binary fission fermentation
- Q Which term describes a corkscrew shaped bacterial cell O spirillum O pathogen O bacillus O COCCUS
- Q Which characteristics are shared by sponges corals humans and frogs They are autotrophic and photosynthetic and are terrestrial They reproduce asexually and possess chloroplasts They are heterotrophic and have no...
- Q What type of cell contains half the usual complement of chromosomes zygote O haploid O diploid all of the above
- Q Which statement is true about the domains of living things Kingdom Bacteria and Kingdom Archaea are in the same domain Domain Eucaryotes includes only Kingdom Protista Domain Bacteria includes Kingdom...
- Q What is the highest taxonomic level O domain O family O phylum O genus
- Q Which term describes a single celled organism that contains membrane bound organelles O autotroph O eukaryote heterotroph Oprokaryote
- Q In Linnaeus s binomial naming system the second name is always what O the specific name O the genus name the clade name the kingdom name
- Q Which of the following is an example of an autotroph tree O dog bird elephant
- Q How does loss of biodiversity affect humans It threatens our food supply O It has a significant economic impact on tourism and forestry O It eliminates sources of natural medicines...
- Q Which of the following gram positive bacteria low G C content is an important probiotic Lactobacillus Leuconostoc Streptococcus Staphylococcus Mycoplasma
- Q 1 Create a brochure over an infectious disease that can be distributed in a healthcare facility The brochure should be professional and informative You may choose your own microbe After...
- Q Professional Development Plan on how to become a cardiac surgeon 1 Develop a comprehensive plan outlining the steps you will take to bridge the skills gap identified in the previous...
- Q on 1 A an occurs when the receiving team successfully puts the ball away against the serving team or when the serving team commits an unforced error and the receiving...
- Q This figure shows the life cycle of a moss Match the letters in the figure with the process that is taking place at that point in the life cycle Use...
- Q Perfect Stigma Imperfect Carpel Style Is this flower perfect or imperfect Ovary Ovule Petal Sepal Anther Filament Stamen
- Q Fruits have contributed to the success of angiosperms by nourishing the plants that make them facilitating the dispersal of seeds attracting insects to the pollen inside producing sperm and egg...
- Q You have now learned about pollination and fertilization in the flowering plants It is important to remember what these two processes are and how they occur Which of the following...
- Q Which of the following is the result of double fertilization OTwo diploid zygotes A diploid zygoe and a triploid endosperm A diploid zygote and a haploid endosperm Two haploid zygotes
- Q In the garden peas studied by Mendel cells of the sporophyte have 14 chromosomes within each nucleus How many chromosomes should be in an endosperm nucleus in the garden pea...
- Q The seeds of a flowering plant consist of a n Select Select tissue endosperm The seed coat is Select em
- Q In a life cycle that shows alternation of generations the sporophyte produces haploid spores through Select while the gametophyte produces Select gametes through mitosis
- Q You find a plant you have never seen before and notice the flowers are relatively small lack any odor and are relatively colorless The flower is most likely pollinated by...
- Q Which of the following is true of fruits Select all that apply They are seed bearing They provide nutrition to the developing seeds They facilitate the dispersal of seeds All...
- Q Monoecious Black Walnut trees are a common tree in Central Pennsylvania their nuts are an important source of food for wildlife They flower in the spring This photo shows those...
- Q Question 7 In seed plants the gametophyte plants 0 5 generation is more reduced than in seedless
- Q Which of the following is a defining character for a nonvascular plant It is the only group that shows an alternation of generations The gametophyte is the prominent dominant stage...
- Q What are the NACE competencies Give me your idea about them and how they work for you
- Q What are the NACE competencies Give me your idea about them and how they work for you
- Q Write a conclusion about emotional intelligence Clifton strengths and NACE competencies and what is the best selfrefection about them
- Q Intracellular receptor Hydrophilic ligand Transmembrane receptor Hydrophobic ligand Cytoplasm Extracellular environment Prov of 36 110010011001 FIT Next bo Signal transduction pathway Cellular response Signal transduction pathway Cellular response
- Q 2 In Drosophila an X linked mutation Bar eye B causes slit like eyes Wild type females X X and males X Y have round eyes Males with the B...
- Q Where along the parent DNA strand does synthesis of the new DNA strand take place Select one a O b Forks are used to pop the replication bubbles O d...
- Q chromosome Some useful information orf is the origin of replication strand A and strand B are referring to the template strands for replication to the right of the origin of...
- Q 1 One form of night blindness the inability to see in low light levels is a sex linked trait in humans controlled by alleles on the X chromosome Normal color...
- Q B Complete the following exercise 1 Make a concept map showing the different types of inheritance analyses
- Q A Construct explanations for the following questions 1 Scientist use zebrafish to understand the processes of meiosis and cell differentiation In the process of a zebrafish zygote developing into a...
- Q the utations in each of the mutants are recessive or dominant you creted partial diploid bacteria by introducing into mutant cells a plasmid carrying an intact copy of the entire...
- Q E When the primer in the middle is removed and filled in with DNA the fragments mu then be joined i Which type of enzyme fills in the DNA after...
- Q D What is the primer s purpose and why do they need to be removed Explain
- Q I P O ZY A I P O Z Y A glucose and lactose lactose glucose Question 33 I P OcZ Y A I P O Z Y A glucose...
- Q glucose and lactose lactose glucose Question 27 ISP O Z Y A repressor can t bind allolactose glucose lactose alunnee Choose Choose Choose Choose Choose
- Q Question 9 SARS D The same region in the genome of virus isolated from a young otherwise healthy patient who exhibited particularly severe symptoms read 5 AAUUACCGUAUAGAUUGUUU 3 What is...
- Q SARS H What is the role of the signal peptide O It s an address it directs the translocation of the protein to the endoplasimic reticulum ER by binding to...
- Q Sketch models of the wildtype lac operon and the adjacent lacl gene and the mutant your friend created Indicate on your sketches the positions of the promoter the operator the...
- Q has an intact WT normal repressor gene 1 and intact lac operon is labeled as I P O Z Y A where superscripted denotes a normal gene or control element...
- Q Amino acid residues 1 through 13 of the spike protein constitute its signal peptide The signal peptide s sequence is H N MFVFLVLLPLVSS coo What is the overall nature of...
- Q You have generated several random mutations in this region One of them is 5 AAUUACCUAUAGAUUGUUU 3 What may be the mutant protein sequence Enter the single letter code for the...
- Q SARS C The Delta Variant of SARS COV2 sequence of the same region is 5 AAUUACCGGUAUAGAUUGUUU 3 What is the mutant protein sequence O H3N NYLYRLF coo H3N NYRYRLF coo...
- Q SARS B SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The original Wuhan isolate of SARS CoV2...
- Q SARS CoV2 is the causative agent of COVID 19 Like all coronaviruses it has a positive sense single stranded RNA genome The spike glycoprotein is an integral membrane protein with...
- Q I P O ZY A deletion in the middle of Z glucose and lactose lactose glucose Question 29 I dp O Z Y A repressor can t bind to 0...
- Q Which of the following does not affect the amount of a certain protein synthesized in prokaryotic cells Mark the correct answer s mRNA processing Use of alternative sigma factors binding...
- Q Match the following mutations with the correct designation of its type i e dominant or recessive N 2 1 d 69 S Is Choose Choose Choose recessive dominant ICH V
- Q It is found that the enzyme X hydrolase also known as formerlyknownastwitter hydrolase is accumulating in cells only when substance X is added to the medium This phenomenon is most...
- Q 1 2 3 tus Signals beginning Signals end 4 5 6 7 8 9 10 11 12 11 Translation Transports amino acids 9 Complements codon 10 A Termination sequence B...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!