Biology question and answers for June 17, 2024
- Q As the pendulum swings towards the lowest part of its swing explain how energy is transferred What type of energy is it losing and gaining
- Q ble 4 Mitosis in Cancerous Chicken Stomach Cells Total of of Cell Cells Cycle Phase of Mitosis Interphase Prophase Metaphase Anaphase Telophase TOTAL 424 50 12 3 11 500 100...
- Q change across elevation Does the relative size of the head change across elevation Hypothesis Body shape in the genus Pristimantis changes across elevation i e across environmental temperature gradient Predictions...
- Q change across elevation Does the relative size of the appendages change across elevation Does the relative size of the head change across elevation Hypothesis Body shape in the genus Phrynopus...
- Q Finding the consensus C The coding strands sequences below represent promoter regions of several genes of the bacterium Generalus geneticus Based on the following sequences what is the average distance...
- Q lack 3 5 proofreading exonuclease activity use nucleoside triphosphates as substrates produce an antiparallel complementary strand to the template synthesize nucleic acids in the direction 3 5 evolutionary well conserved...
- Q In prokaryotes initiation of transcription involves Obinding of the TATA Binding Proteins TBP to the TATA box and recruitment of RNA Polymerase scanning of the DNA by RNA Polymerase holoenzyme...
- Q Finding the consensus B The coding strands sequences below represent promoter regions of several genes of the bacterium Generalus geneticus Based on the following sequences what will be the most...
- Q A B The following are four different potential outcomes for the Meselson Stahl experiment Please match the outcome on the left with an interpretation i e the model compatible with...
- Q that would result It THCS Mad chudren A Last the possible genotypes and phenotypes for their children B What are the chances of a child with light blue skin C...
- Q 5 Patrick met Patti at the dance Both of them are heterozygous for their pink body color which is dominant over a yellow body color Create a Punnett square to...
- Q 1 2 PHASE 2 Phases of micrograp Complete the Match micr micrograph meiosis I b the images stained red Select Veri
- Q Copper Number method Arrow method Nobel Gas method Arrow Number Thorium Nobel Gas Arrow Number Nobel Gas
- Q I Anaphase I Telophase I Cytokinesis 1 2 PHASE 2 Phases of mei micrographs Complete the follo Match microsco micrographs to meiosis I by re c the images chro stained...
- Q RATORY SIMULATION
- Q 83 A 1 2 3 Phases of m whiteboard Complete the fo Place the sket undergoing m by moving the whiteboard Place each na under correct names into the whiteboard...
- Q Question 18 1 point Describe what happens when seawater is consumed to quench thirst a Seawater draws water out of the body resulting in further dehydration and diarrhea Seawater can...
- Q Drag each label to the correct location on the diagram of a tetrad Labels i Drop Zones Sister chromatids Centromere Synaptonemal complex Kinetochore Homologues Reset All
- Q Explain define the role of both afferent and efferent signals in regulating the clock
- Q Figure 14 1 illustrates a reflex arc directing which organ O the stomach O the eye O the heart the liver
- Q Figure 14 7 shows effects of the sympathetic system which include the pupil heart rate blood vessels to skeletal muscles and blood vessels to the digestive tract Note all of...
- Q Question 6 Points 2 Based on the tax and spend label given to liberal Democrats how did John F Kennedy seem to break that mold He proposed to cut taxes...
- Q Figure 14 1 illustrates a reflex arc directing which organ O the stomach Othe the eye the heart the liver
- Q What are the roles of introns and exons and why is alternative splicing an important mechanism for these processes
- Q What is eukayotic initiation and what are the steps involved in it
- Q Why are introns considered beneficial if they are are spliced out of the RNA transcript
- Q How do introns contribute to the complexity and diversity of gene expression and protein synthesis
- Q Can you please make a question about Eukaryotic Initiation step 6 in your own words
- Q 3 Why are introns considered beneficial if they are spliced out of the RNA transcript
- Q Can you please type two paragraph about Eukaryotic Initiation step 6 in your own words
- Q 2 What are some similarities and differences that you noticed between transcription and replication
- Q 1 Why is transcription the first step in gene expression
- Q write 1 take home message about the professional patent The take home message must be followed by an explanation short essay on how that take home message may help you...
- Q KRANKOS Meiosis V 1 VAG Prophase II Germ line cell Meiosis II 6 Meiosis I Do not replicate Chromosomes Anaphase II These four along the bottom go in stage specific...
- Q Question 3 x is the two word name of the process happening below Spelling counts A b B C C C a C C a C C C a C
- Q The moment of fertilization is also known as which produces a which is a fertilized single cell 1 points
- Q Question 2 When talking about the chromosome number in a cell if the cell contains the full number of chromosomes we use the term we refer to the chromosome number...
- Q 1 Joachim is at a party with his friends Some of his friends are being inconsiderate and disrespectful by bullying a new kid from their neighborhood who is also at...
- Q Mutation questions Transcribe then translate this normal sequence of DNA all questions below will refer to this sequence 5 GGTATGGCCGCACAATAGTTGC 3 3 CCATACCGGCGTGTTATCAACG 5 I 18 19 The original DNA...
- Q the process of transduction usually begins when when the signal molecule or ligand attaches the receptor protein and changes the receptor in some way after the target cell divides after...
- Q Match the following with the descriptions paracrine signaling Examples of second messengers Apoptosis endocrine signaling Choose Example of long distance signaling CAMP Inositol triphosphate calcium Programmed cell death example of...
- Q The phenotypic ratio resulting from a DIHYBRID showing independent assortment is expected to and the phenotypic ratio resulting from a MONOHYBRID cross showing independent assortment is expected to be be...
- Q The three stages of cell signaling is order are the paracrine local and synaptic stages Osignal reception signal transduction and cellular response signal reception cellular response and signal transduction
- Q Having two identical alleles for a gene is called whereas having different alleles is
- Q Two gametes combine during fertilization to form the Zygote restoring the Diploid haploid Haploid diploid stag
- Q Homologous chromosomes carry the alleles of the gene or character and have the le same same different same Same Different 5 56 JCC
- Q What is polygenic inheritance occurs when one gene influences many characteristics a single phenotypic character results from the additive effects of two or more genes two dominant alleles affect the...
- Q Two gametes combine during fertilization to form the Zygote restoring the Diploid Haploid O Haploid Diploid stage
- Q What is pleiotropy occurs when one gene influences many characteristics a single phenotypic character results from the additive effects of two or more genes two dominant alleles affect the phenotype
- Q All the offspring of a cross between a RED flowered plant and a WHITE flowered plant have PINK flowers blending of traits intermediate phenotype This is an example of what...
- Q The genetic makeup of a trait is called whereas the observable expression of a trait is Phenotype genotype
- Q A biological human male having the normal sex chromosomes has whereas a biological female having the normal sex chromosomes has chromosomes two X chromosomes XX one X chromosome and one...
- Q If dimples is a dominant trait what is are the possible genotypes of an individual having dimples Homozygous dominant DD Homozygous recessive dd Heterozygous Dd Both Homozygous dominant and heterozygous
- Q Regarding mitosis and cytokinesis one difference between plants and animals is that O A cleavage furrow forms during cytokinesis in both animals and plants in plants a cell plate begins...
- Q Which two terms will make the following statement true produces offspring that are identical to the original cell or organism and produces offspring that are similar but show variation in...
- Q Indicate which of the following lists the correct order of stages of mitosis a Metaphase anaphase interphase telophase prophase Interphase prophase promethaphase metaphase anaphase telophase Telophase anaphase prometaphase metaphase prophase...
- Q 5 1 2 4 3 Date What kind of gametes does a person of genotype AaBb produce What kind of gametes does a person of genotype DdEE produce Brown hair...
- Q 3 7 In humans normal skin pigmentation is due to a dominant gene A albinism to its recessive allele a A normal man marries an albino woman their first child...
- Q Three Proteus vulgaris Two S m and P v will be under the positive glucose fermentation to acid and P p will be under the branch for the negative reaction...
- Q How did we prepare an MHA plate for the Kirby Bauer method to test for antimicrobial susceptibility in the micro lab Choose the best answer Aseptically add the antibacterial disks...
- Q Question 11 1 pts What is the first step to unknown identification when you receive the slant Choose the best answer Aseptically perform a gram stain from the unknown culture...
- Q Which of the following choices is the method we used to evaluate the effect of UV light exposure on E coli and B subtilis in the lab We divided one...
- Q 18 10 Source Chegg com 106 LILO 107 Only one plate could be used 10 5 because above this plate you have TNTC and below it TFTC O We can...
- Q Use the following diagram to match the questions to the correct answers Oxidation Fermentation Test Procedure Source Biolife E Which test supports positive facultative anaerobic utilization of dextrose Which test...
- Q lowing paragraph and table to answer the questions that follow Points for each the data estion are in bold at the end of the question Organisms get energy from the...
- Q 91 Question 2 Chromosome Duplication and Segregation Name and discuss the two chromosomal sequences structures areas and their functions whose job it is to ensure that the duplication and number...
- Q B It is common for cancer cells to have lost p53 activity Based on what you know about p53 function and regulation what regulatory mechanisms might be disrupted in p53...
- Q Observe the following table of biochemical tests and Gram negative bacilli Answer the questions below by choosing the best answer from the pull down menu Fermentation and Oxidation in Gran...
- Q Observe the growth of bacterial colonies on these plates Which dilution factor plates would not be appropriate to use to determine bacterial concentration Why Exercise 5 results 10 105 10...
- Q If you have a series of PR sugar fermentation test tube results after proper incubation what would be the interpretation for each of the following observations Match the questions to...
- Q Here is the formula to calculate bacterial concentration using the spread plate technique viable count CFU mL CFU x dilution factor over the volume of culture plated in mL What...
- Q Erythromycin Amoxicillin Classic Acid Which drug would be preferred for a patient with an E coli infection Which drug would be preferred for a patient with an S pyogenes infection...
- Q Erythromycin Amoxicillin Clavulanic Acid Which drug would be preferred for a patient with an E coli infection Which drug would be preferred for a patient with an S pyogenes infection...
- Q Use the following diagram to match the questions to the correct answers Oxidation Fermentation Test Procedure Source Biolife E Which test supports positive facultative anaerobic utilization of dextrose Which test...
- Q If you have a series of PR sugar fermentation test tube results after proper incubation what would be the interpretation for each of the following observations Match the questions to...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!