Biology question and answers for June 14, 2024
- Q Question 40 NADPH is made by O chemiosmosis O glycolysis the Krebs cycle O the Calvin cycle the passing of electrons from photosystem I to an electron transport chain
- Q Question 4 Based on the graph what are the optimal temperatures for the human enzyme and hotsprings prokaryote enzyme Rate of Reaction OO Copyright The McGraw Hill Companies Inc Permission...
- Q at is biomagnification
- Q Climbing a wall of ice requires careful interaction among all parts of the body You probably know that muscles and the brain work together to coordinate the climber s movement...
- Q What does an indicator species tell us about the health of an ecosystem
- Q Describe three ways people can decrease their ecological footprint to help manage Earth s resources
- Q Are humans likely affected by biomagnification If so which foods might be dangerous
- Q How do human organ systems interact to provide for the needs of the human organism
- Q Identify pollutants that contaminate water ecosystem
- Q How might global warming affect seasonal temperature changes
- Q How are particulates harmful to the biosphere
- Q xplain how an increase in greenhouse gases contribute to an increase in average global temperature
- Q What is global warming
- Q What is the greenhouse effect and how does it keep Earth warm
- Q Identify 5 pollutants that accumulate in the ai
- Q What is the difference between renewable and nonrenewable resources
- Q ow does a person s ecological footprint relate to the amount of resources they consume
- Q List 2 examples of nonrenewable resources you use regularly
- Q List 2 examples of renewable resources you use regularly
- Q List factors that affect the size of an ecological footprint
- Q What is an ecological footprint and how is it related to an area of land
- Q Summarize what is meant by Earth s carrying capacity
- Q Give an example of how technology has influenced human population growth
- Q d What is the probability 50 20 The color of flowers in snap dragons shows incomplete dominance Red CC and white CC are homozygous and pink C Cw is heterozygous...
- Q Mark all substances on this list that can normally pass through the blood brain barrier small lipid soluble nonpolar drugs gases like oxygen and carbon dioxide glucose because there s...
- Q Which one of the following functions of CSF allows CSF to protect the brain from its own weight OCSF helps regulate electrolyte levels within the brain CSF allows the brain...
- Q Ependymal cells are a type of neuroglia One of the functions of ependymal cells is to produce CSF from fluid that leaks out of the choroid plexus Where does CSF...
- Q Name the two structures of the brain that are directly concerned with maintaining your body s homeostasis the hypothalamus the reticular formation the thalamus the cerebellum
- Q If you cut the brain in the midline between the two halves of the thalamus what structure do you cut through between those two halves the corpus callosum the hypothalamus...
- Q look at the inferior surface of the brain anterior to the optic chiasm pull apart the frontal parietal and temporal lobes make a midline incision through the corpus callosum follow...
- Q If you were to pull the cerebral cortex into the shape of a blanket rather than all of the ups and downs of gyri and sulci how big would it...
- Q 5 Met Pro GG Translation Translation Ser AUGCCUAGUCGGUAAAAA AA 3 Arg Met Phase AUGCCUAGUCGGUAAAAAAAAA 3
- Q 36 If the temperature of a rock unit is elevated significantly the rock is more like a Deform plastically than elastically b Undergo brittle failure than plastic deformation C Deform...
- Q 24 Volcanoes have a positive service function by a Replenishing soil with nutrients b Lava flows creating ghost forests for us to marvel Allowing fluorine in water that is ultimately...
- Q a 18 The portion of the Earth C a b Lithosphere c Asthenosphere d Both a b 19 Tectonic plates are actively separating in all of the following EXCEPT a...
- Q 48 A lateral blast from a volcano Is called a Pelean eruption a b Common with plinian eruptions such as Mt St Helens Can generate pyroclastic flows d All of...
- Q b The frequency of the wave The wavelength of the wave d Amplitude of the largest peal 43 Surface rocks at low temperature are most likely to a Experience brittle...
- Q c Compressive stress the hanging wall moves down relative d Compressive stress the hanging wall moves up relative to the footwall 31 Elastic deformation may occur when rocks are subject...
- Q The wave length of a wave is a The distance between disturbances b How large is the disturbance c How destructive the wave will be d The waves frequency
- Q 6 With a fault when displacement is not apparent at earth s surface this faul a Blind fault b C Dip slip fault d Normal or gravity fault 7 At...
- Q 12 Carrying capacity means The maximum number of people the environment can contain without degradation b The ability of a fault to hold stress C Population momentum d Indirect result...
- Q B Page 246 Although the Halley Bay population of Emperor penguins was declining prior to 2016 it completely disappeared from 2016 2018 Which statement best describes what happened to the...
- Q Even with the most recent advances in microscopy it is impossible to image atom O True O False
- Q ne coll bacteria is suspended in water which has a viscosity of r 0 8 x 10 N s m and a density of 1000 kg m Assuming the water...
- Q What is the START codon Can you locate the START codon above What is the function of the Shine Dalgarno Sequence Where is it located The Shine Dalgarno sequence is...
- Q Which of the following best describes how the process of crossing over during meiosis leads to an increase of genetic diversity During Prophase 1 sister chromatids separate from each other...
- Q Programmed cell death may be initiated by which of the following O cyclin O MPF P21 4
- Q A cell is 2n 24 The cell has completed Telophase and Cytokinesis 2 How many chromosomes does it have per cell Are they replicated or unreplicated O 12 replicated O24...
- Q The total DNA content of each daughter cell is reduced during meiosis because O chromosomes replicate during the interphase between Meiosis I and Meiosis II O homologous chromosomes separate in...
- Q Which of the following is not true of sister chromatids O they are joined by a centromere during prophase and metaphase O they segregate from each other during mitotic anaphase...
- Q Independent assortment refers to the way in which multiple sets of chromosome pairs can align on the metaphase plate druing Meiosis 1 True False
- Q If 2n 24 and a body cell is at G1 after completing mitosis how many chromosomes are present per cell are they replicated or unreplicated 12 unreplicated 24 unreplicated 12...
- Q The ratio of the amount of DNA present in a Meiotic Prophase I cell to that in a Meiotic Telophase II cell is 4 1 3 1 2 1 none...
- Q A cell lacks sister chromatids in a mitotically active tissue The cell in question is most likely in OS O GO G1
- Q Which of these statements is false O In humans the embryo contains homologous pairs more than one choice is incorrect In humans gametes have originated from diploid cells
- Q DNA is duplicated twice during meiosis Once during the interphase preceding meiosis I and again in the interphase preceding meiosis II O True False
- Q 2n 18 How many chromosomes are present per cell at Prophase of Mitosis and are they replicated or unreplicated O9 unreplicated O 18 replicated 9 replicated 18 unreplicated
- Q Non tumor somatic cells may divide 20 50 times before death occurs none of these is correct a b c be subject to constant division cease division when mature
- Q 2 Describe the structure and function of the following organelles a ribosomes b rough ER c smooth ER d Golgi complex e mitochondria f lysosomes g vacuoles bloroplast
- Q QUESTION 1 Place in order the steps of the scientific method V Analyze Results Run Experiments
- Q A neutron is a subatomic particle that has a negative charge True False QUESTION 8 The subatomic particle that determines reactivity is the electron O True O False
- Q QUESTION 9 Match the macromolecule with its characteristics Lipids Nucleic Acids Carbohydrates Proteins QUESTION 10 Match the cell structure or component to it s function character Nucleus A Structural or...
- Q QUESTION 3 Match the structure of the microscope to its function Arm Stage Revolving nose piece Ocular Base QUESTION 4 If the total magnification of a microscope is 600X and...
- Q As your magnification increases your field of view increases as well O True False QUESTION 6 A proton is a subatomic particle that has a positive charge O True O...
- Q What is the response when baking soda is place in vinegar O There is a chemical reaction and the solution turns black O A chemical reaction occurs and bubbling is...
- Q 10 11 9 8 6 7 Hand Instruments Instrument used to remove soft dentin and decay from the tooth Multifunctional instrument with the sharp point at the tip sensitive to...
- Q 1 Karine s friends are asking her to do heroin with them She doesn t want to join in this potentially life threatening behavior but isn t sure how to...
- Q The recessive alleles for scute bristles s and ebony body e identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous for these genes were crossed...
- Q The recessive alleles for mahogany eyes m and ebony body e identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous for these genes were crossed...
- Q The recessive alleles for cinnibar eyes c and vestigial wings v identify two autosomal genes on the third chromosome of Drosophila melanogaster When females heterozygous at these two genes Cc...
- Q Question 15 If the recombination frequency between P and O is 7 4 and between N and O it is 7 9 what is the likely order of these genes...
- Q A wild type allele is the most common allele for a gene in a population expressed in the heterozygous state expressed only in the homozygous state always beneficial to the...
- Q Consider the relative map distances between four genes on the chromosome shown here What is the expected recombination frequency between genes X and Z W X Y 2 15 10...
- Q You are studying two genes that are located on the same chromosome They are located 55 map units apart How will the alleles of these genes behave in a dihybrid...
- Q Red green color blindness is X linked in humans If a male is red green color blind and both parents have normal color vision which of the male s grandparents...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!