Biology question and answers for July 06, 2024
- Q 2 The basic hypothesis that we re working with for the formation of BIFs is that during the Hadean and Archean iron Fe accumulated in the oceans until the oceans...
- Q 1 Most BIFs are banded which indicates episodic precipitation of hematite Make a conjecture about why this pattern exists Hint Remember that the precipitation of hematite depended on oxygen supply...
- Q I Does the size of acritarchs support the interpretation of them representing eukaryotes
- Q 6 cm 10days x 365 days I year
- Q purple and sulphur bacteria 1 List one of the metabolic reactions that cyanobacteria use cyanobacteria fermenters
- Q 1 Identify the following metabolic reactions from the list provided FeS H S FeS2 H chemical energy 2H S CO2 light CH O H O 2S H O CO light...
- Q PRE LAB QUESTIONS Read through the lab introduction and procedures and answer the following questions a How does the movement of molecules compare between solutions at room temperature versus 45...
- Q Table 1 Osmosis and Temperature Results Initial Weight g Final Weight g Weight Change g Change 60 Karo s dyed blue 60 Karo s dyed blue 23 31 22 24...
- Q Regarding the MNS blood group which point is correct O Anti M and anti s are a cause of HTRS O Anti M and anti S are lgG O Anti...
- Q Master mix 1 GFP pUC19 F 5 CCAGGCTTTACACTTTATGCTTCC 3 GFP PUC19 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3 Master mix 2 GFP PBR322 F 5 GATGACGATGAGCGCATTGTTA 3 GFP PBR322 R 5 CTTTGATTCCATTCTTTTGTTTGTCTGCC 3...
- Q How does natural selection influence which traits are passed on to future generations OA Traits that increase the diversity of the population are more likely to be inherited B Traits...
- Q Some hares have the same coat color all year long Others have white coats in the winter and brown coats in the summer Variations in their influence when individuals begin...
- Q Identity Cultural Narrative 10 pts For this first writing assignment students will reflect on how race ethnicity language culture gender sex and sexuality have shaped their identity Some essential questions...
- Q BIU Question 2 ET T Would it have been possible to determine the identity of the unknown if a whole egg was used instead of only the albumin Explain you...
- Q Question 2 Did the Benedict s test of reducing sugars for the glucose and milk samples indicate similar sugar content Reference Data Table 1 and Photo 1 in your explanation...
- Q Please list and explain the functions of the 5 main types of proteins 18 allilled al Jig so
- Q Passive Transport a type of passive transport where molecules move from a region of high concentration to a region of low concentration the diffusion of water through a partially permeable...
- Q An solution is when the concentration of solutes is the same inside the cell compared to the surrounding solution Water molecules are in a dynamic meaning that there is equal...
- Q Question 8 This diagram shows an reaction Free energy time products reactants
- Q Listen What do chloroplasts and mitochondria have in common that no other organelle contains What does this provide evidence for Explain
- Q All of the following are true about the Tuskegee Syphilis Study EXCEPT a Information related to treatment was withheld from participants b Participants were treated with penicillin when it was...
- Q 2 Although they had been talking online for six months John felt some trepidation about meeting Luisa face to face Past girlfriends had called him insensitive and one had even...
- Q Choose two types of lateral gene transfer to compare and contrast the type of genetic information that is transferred the mechanism of transfer and under what conditions each type of...
- Q on 1 Match each reagent to the macromolecule it identifies Benedict s reagent tt Biuret s reagent IKI solution Sudan III reagent Dische diphenylamine Reducing sugars Starches Lipids Proteins DNA...
- Q nique let you isolate two mixed species from a mixed species culture b How can you be sure you have a pure culture of one species And why is getting...
- Q b Why do you flame the mouth of the tube and heat the loop to red hot c What would your results have looked like if you forgot to sterilize...
- Q AOTD What type of stimuli are detected by the ampullae of Lorenzini in hammerhead sharks Photons Tastes Electricity Smells
- Q Which of the following is depicted in this figure of nutrient cycles and energy flow in a terrestrial ecosystem below Sun Respiratory loss work and heat Organic storage Gaseous exchange...
- Q ation Spicules Choanocyte Archaeocyte create water currents and engulf food particles Based on your reading match the sponge cells to their individual functions protective and contractile variety of functions such...
- Q Which of the following numbers is NOT a solution of the inequality 3x 5 4x 3 A 1 B 2 C 3 D 5
- Q List the geologic layers from oldest to youngest B 1 F H C E GI BI 3 J A I D
- Q List the geologic layers in order from oldest to youngest R B H BIU E M I H R M FS
- Q Data Tables for Frog Clade Note Columns A D should be filled in with either a 0 same trait condition as outgroup or a 1 different trait condition than outgroup...
- Q 5 Now please look at the two articles that you have downloaded Note that they are formatted very differently Every journal has their own requirements for how journal articles and...
- Q 1 You are given a mixture containing two compounds A and B Both compounds have a solubility of 1 00 g 100 mL of solvent at 20 C and 12...
- Q 1 Name the major groups of land plants represented by letters A E on the phylogenetic tree 25 each Provide example members of each of the major group 25 each...
- Q following the instructions below a Go to the library webpage https library csub edu b In the search box type in Ecology This search will pull up all titles with...
- Q 3 Another great resource is Google Scholar not just Google The easiest way to use Google Scholar is to have a Google account If you do not have one already...
- Q 6 There are many different resources that may be used However not all resources are reliable So it is important to learn how to discern reliable resources from resources that...
- Q Which of the following are attributes of organelles may survive outside of the larger cell lives inside other cells has own DNA RNA replicates itself membrane bound
- Q Which of the following are attributes of organelles has own DNA membrane bound Oreplicates itself Olives inside other cells
- Q Prior to conducting any scientific investigation you need to learn as much as you possibly can about the biology of the organism in question To learn about the biology of...
- Q We often think of evolution as a tree and that s roughly accurate Populations split and diverge and become new species and so one branch becomes two But the concepts...
- Q Contrast the body organization of the basic body plan of each Upload discussion and sketches of Porifera Cnidaria and Coelomates and provide a sketch
- Q Oxytocin O Q Exerts its most important effects during menstruation Controls milk production Release is an example of a positive feedback control mechanism Is an anterior pituitary secretion
- Q Match the structure with its function Transmits sound vibrations to auditory ossicles Senses changes in dynamic equilibrium Organ that houses receptors for hearing Senses changes in static equilibrium Macular in...
- Q he makes hormones that are transported to the Hypothalamus anterior pituitary Hypothalamus posterior pituitary Posterior pituitary hypothalamus Anterior pituitary hypothalamus via the bloodstream and trigger release of more hormones
- Q You are called in to track outbreaks of a new disease called simpox in two neighboring towns Springfield and South Park Simpox is spread by direct contact between people in...
- Q 1 20 points Many species of bacteria are becoming resistant to antibiotics Recently studies have analyzed the chromosomal DNA of antibiotic resistant bacteria One bacteria studied is methicillin resistant Staphylococcus...
- Q critical immunization threshold The critical immunization threshold symbolized pe is the minimum proportion of a population that must be individually immune to a disease in order to achieve herd immunity...
- Q What is one common mistake taxonomists may make when attempting to place seemingly closely related species into a shared classification group The two species seem to be located in the...
- Q homology and biogeography Sort the following examples into the correct categories The evidence exists in a variety of categories including direct observation of evolutionary change the fossil Drag each phrase...
- Q 12 Multiple Choice Questions 12 14 refer to the pedigree below The trait being represented is caused by a rare genetic mutation that results in severe weakening of muscles with...
- Q 10 For each of the following problems using the information below determine the parent genotypes draw the Punnett square and provide the possible genotypes and phenotypes of the offspring Each...
- Q 9 In horses black is dependent upon a dominant gene B and chestnut upon its recessive allele b The trotting gait is due to a dominant gene T the pacing...
- Q lete the following dihybrid crosses Using the information provided in each problem and the steps d below answer the questions of this worksheet to the best of your ability Each...
- Q The purpose of the reaction buffer Tris HC1 KC1 and MgCl in the PCR mixture is to O a Provide the DNA template for Taq polymerase to bind to Ob...
- Q An amplicon is a PCR product and the DNA to be amplified is the template True False Question 4 1 point Listen Positive and negative controls are necessary in experiments...
- Q Taq polymerase is extracted from O a Saccharomyces cerevisiae O b Escherichia coli Oc Thermus aquaticus d Bacillus cereus who lives in hot springs
- Q DO True False
- Q An amplicon is a PCR product and the DNA to be amplified is the template O True False
- Q In sequential order which are the three steps of PCR O a Denature DNA Extend DNA Anneal Primers O b Anneal Primers Denature DNA Extend DNA O c Denature DNA...
- Q 27 Please list the 5 main components of the endomembrane systems and provide their main functions
- Q Record 5 data points for the Oxygen Percent Concentration time period Record your oxygen concentration points below If possible get a wide range of percentages Date Collected Oxygen Pet Sat...
- Q Based on what you know and what you have learned abel the anatomy of the urchin with the letter that fits each organ You may also visit http purpleseaurchinreasource weebly...
- Q Which of the following should be done before returning your microscope to the cabinet Select all that apply Lower the stage to the lowest point Remove the ocular lens Place...
- Q Which of the following best illustrates SELECTIVE ATTENTION for perception of inputs O Listening to music while exercising in order to avoid focusing on the pain in your body from...
- Q O The sequence of events is important O Each stage of processing relies on the prior stage O All of these O Once all elements have been processed a decision...
- Q O Theories explain how things work O Knowledge is innate O Knowledge comes from experiences Selective attention is needed for thinking Question 9 Which of the following best illustrates an...
- Q Although no one is sure of why the glaciation began it s clear once it got underway there would be positive feedback due to the ice itself Why
- Q hat is a controlled experiment Please give a detailed example of a controlled periment
- Q Organisms may have survived by staying near O staying near hot springs O the surface of the earth O burying themselves in soil O basking in the sun
- Q Why did the ice cover finally melt O the interior of the earth got hotter O carbon dioxide from volcanoes created a greenhouse effect O the sun became hotter
- Q Choose one of the organisms below as an example and discuss at least two functions that skeleton performs for the creature
- Q Snowball earth occurred O about 3500 Ma O about 100 200 Ma O about 700 600 Ma C about 2500 M
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!