Biology question and answers for November 28, 2023
- Q The figure below shows a pedigree for the inheritance of a phenotype in a family Which of the following is correct O Father Affected Mother Normal Son Affected Daughter Normal...
- Q the F generation of Mendel s experiment one out of four plants had white flowers because both parents were heterozygous white O both parents were heterozygous purple O one parent...
- Q Which statement best describes the biogeography of species observed by Charles Darwin OA Species spread rapidly so geographical distance between species is unrelated to their evolution B Species cannot evolve...
- Q As a population declines in numbers it gains genetic diversity O True O False
- Q Which type of RNA guides chemical modifications of other RNAS A TRNA C tRNA B snoRNA D snRNA
- Q 9 For the admix tests what do genetics companies use to tell you what percent of DNA you have from around the world They make a random guess about which...
- Q 7 Thomas Jefferson did not have any legitimate sons with his wife Martha that survived to adulthood Why did Dr Foster want to use the Y chromosome from Thomas Jefferson...
- Q 5 Why did the scientists use King Richard III sister s descendants to match to his mtDNA O Because they could have chosen any of his descendants they just had...
- Q DNA 0 adder AmoebaSisters MULTIPLE CHOICE QUESTION 3 1500bp YouTu Which fragment will travel the FURTHEST from the well
- Q In rabbits the homozygous CC is normal Cc results in rabbits with deformed legs and cc is lethal For a gene for coat color the genotype BB produces black Bb...
- Q DTO TO oft OTO BO O Co dominant O Dominant O Incompletely dominant Recessive
- Q Several orchards in different regions were planted with apple trees produced from a single parent tree The table below shows data gathered from the three apple orchards Which of the...
- Q Which of the following alleles control the blood type O A OB O O
- Q Which of the following refers to an alternate form of a gene in the same position on a pair of chromosomes O Loci O Allele O Genes O Chromosome
- Q hich of the following statements is NOT true about an X linked recessive trait O The trait is always passed on from father to son O The trait is inherited...
- Q The pedigree given below shows I II III 2 3 TO Q OAY linked recessive trait O An autosomal dominant trait O An X linked dominant trait O An X...
- Q Taste blindness is the inability of individuals to identify PTC a bitter tasting chemical The pedigree below shows the inheritance of taste blindr family Which of the following best describes...
- Q Down Syndrome is caused by which of the following mutations A only 45 total chromosomes B only an X chromosome and nothing else C two X chromosomes and a Y...
- Q What does the following symbol in a pedigree chart represent O O Mating O Identical twins O Affected
- Q The figure below shows a pedigree The trait inherited in this family is a O dominant O O non dominant Orecessive trait
- Q 1 Mice collected from the Sonoran desert have two phenotypes dark D and light d The mice shown below were collected in a trap Calculate Dames F choro A The...
- Q a of their parents grandparent to child in question who is blood group O Considering only the ABO blood characteristic explain all the possible blood groups their child could have...
- Q In humans thick eyebrows are dominant to narrow and separated are dominant to joined unibrow Daniel has a very thick unibrow and is worried his future children will as well...
- Q Explain whether the haemophilia allele is dominant or recessive In the space below and using appropriate symbols predict the phenotype and gender of all pos offspring for a female carrier...
- Q Recall that in Mendel s peas yellow is dominant to green and round is dominant to wrinkled Parent plants where one is homozygous for yellow and wrinkled peas and the...
- Q Evolution is one of the unifying themes of biology Evolution involves change in the frequencies of alleles in a population For a particular genetic locus in a population the frequency...
- Q Rabbits may have brown or white fur Assume that the inheritance of fur colour depends on the transmission of a single gene via a single pair of alleles in accordance...
- Q The ABO blood type is an example of O Dominance O Blending O Incomplete dominance O Codominance O Sex linkage
- Q 17 cod in 18 20 tomora Phase AZ sogressm Met UAC 19 AUGCCUAGUCGGUAAAAAAAAA Sul to find dimodis 21 3 First the initiation phase takes place The two pieces of the...
- Q pel the diagrams as you read the following passage 22 24 23 Phase Met Pro GGA Ser UCA Translation Part 3 Met Pro Next the elongation phase begins The ribosome...
- Q Label the diagrams as you read the following passage 22 24 23 Phase Translation Part 3 Met Pro S A Class AUGCO 05M Date OGGUAAAAAAAAA 3 Next the elongation phase...
- Q Free earlobes are dominant over attached earlobes If two people with attached earlobes mate what will be the phenotype of their offspring O all free earlobes O all attached earlobes...
- Q Name Label the diagrams as you read the following passage AUDO 17 20 12 13 m Translation is the process cells use to build new proteins using messenger RNA instructions...
- Q ck Question 38 What type of blood can an offspring of parents who both have type A blood have O Type A only O Type A and O Type A...
- Q mRNA O Ribosome O tRNA is the product of transcription O Codon O Anticodion
- Q estion 94 woman with type A blood has a child with a man who is type B blood Is it possible for the child to have type O bod Yes...
- Q What is transcription The manufacture of a strand of RNA complementary to a strand of DNA O The manufacture of a protein based on information carried of RNA O The...
- Q Question 88 Choose the following letter designation for attached unattached earlobes that represents homozygous recessive genotype EE Ee 1 pt ee
- Q All of these karyotypes are aneuploid EXCEPT one of them Which ONE is the exception O A 45 X OB 69 XXX O C 47 XXY O D 47 XY...
- Q Which one of the combinations of egg and sperm chromosomes is the best explanation for the origin of the karyotype in a male exhibiting Klinefelter s syndrome 4 XXY OA...
- Q A trait s heritability is the proportion of its variation tha cannot be explained is the product of genes and environment O results from the environment alone O is inherited
- Q Mendel s Data Mendel performed similar crosses with other F plants Each time he crossed plant showing different versions of a trait and observed parental traits that were absent the...
- Q in guinea pigs the allele for black cost color B is dominant over white coat color b When two black guinea pigs are crossed they produce 15 black pigs and...
- Q In fruit flies there are two common variations alleles of a particular body color gene The brown allele B is dominant to the black allele b When a pair of...
- Q Bl DEFINE THE FOLLOWING TERMS 1 DOMINANT 2 RECESSIVE 3 HOMOZYGOUS 4 HETEROZYGOUS 5 GENOTYPE 6 PHENOTYPE 7 PROBABILITY COMPLETE THE FOLLOWING PROBLEMS 8 In Rabbits black fir color B...
- Q Polygenic inheritance is the genetic phenomenon that results in a color continuum of skin tones lightest to the darkest skin tone relates to the amount of melanin expressed There are...
- Q Which of the following statements are true about sexual reproduction Select all that apply Organisms that have the same phenotype for a gene also must have the same genotype for...
- Q 06 2 SLO 11b APPLYING You count the number of cytosine C nitrogenous bases in a single DNA molecule and find that they represent 23 of the total number of...
- Q A red flower with genotype of RR is crossed with a white flower with genotype of WW The first generation offspring with genotype of RW are all pink What is...
- Q xa a XX a X Y a xa ya x y What are the frequencies of occurrence for the allele combinations from this Punnett square Do you results agree with...
- Q X Xo a X x x a X Y Y xa x x y 4 What are the frequencies of occurrence for the allele combinations from this Punnett square Do...
- Q How does a dihybrid and monohybrid cross relate to real world situations when trying to predict a specific trait for the offspring of two parents
- Q Tally Total 9 I Tally II Total 11 Frec quency e
- Q Mom The presence of freckles F is dominant to no freckles f Jake and his mom have freckles but his sister and Dad do not have freckles Complete the Punnett...
- Q I faced both dren will have Blue Face they have manue A 100 B 090 C 2590 D SOC
- Q Explain what a complementation test is and its purpose Explain why the two parental mutations must result in a loss of function and are both recessive to the corresponding wild...
- Q Create a pedigree of your family immediately family starting with your grandparents your mother father your siblings your cousins
- Q A woman with type A blood gives birth to a baby with type O blood Can the father have type B blood Can he have type A blood Can he...
- Q O All black O All white O 50 black 50 white O 3 1 black to white lack and white ons vould you expect
- Q In tomatoes tall vines T are dominant to dwarf vines t and red fruit R is dominant to yellow fruit r A farmer mates a homozygous tall red tomato plant...
- Q A black dog and a white dog have puppies All the puppies have black fur Which trait is dominant O Black White
- Q igen AMG ni seeming AMG to noilorul erti el sW 01 abne 15 In eukaryotes introns are removed before mRNA leaves the nucleus because a they do not code for...
- Q Biology Explain why the length of DNA or the number of chromosomes does not correlate with the perceived complexity of organism hint think about the amount of coding and non...
- Q heterozygous A person with this class of genetic disease is homozygous dominant or the affected gene will be somewhere between chromosome pair 1 22 The inheritance pattern of the genetic...
- Q Choose all that apply OHH O Hh Ohh Question 8 s possible genotypes for this trait Suzy has a long coat which is the recessive trait h What is Suzy...
- Q Home 31 ard Not 32 Student Enzymes are not destroyed in the reactions that they catalyze Instead they are available Ora Fale Rowers can be white pink or red This...
- Q A person with this class of genetic disease is homozygous recessive Homozygous dominant and heterozygous individuals are normal the affected gene will be somewhere between chromosome pair 1 22 The...
- Q 2 a Identify three types of RNA and provide a description of each and the role they play in protein synthesis 6 marks
- Q 2 Based on the following genotypes determine the phenotype T can roll 6 In humans tongue rolling is dominant to not being able to roll the tongue t not rall...
- Q Part 4 Answer each of the following questions You must include a Punnett square to support each answer 18 In fruit flies brown bodies B are dominant to black bodies...
- Q b Describe two ways that errors in replication are corrected
- Q 7 NADP and ATP are important products of the light reaction phase and are needed in the dark reaction phase 8 The cyclical process of the dark reaction phase of...
- Q Dr O Brien extended his findings about the delta 32 mutation by looking for the mutation in descendants of survivors of the black plague in Great Britain Because the bacterium...
- Q 9 Harry has Type AB blood He marries Sally whom is heterozygous for type B blood Based upon their known genotypes what is the possibility they could have a child...
- Q 0 00 0 21 A C B Speed 1x An allele is a variation of a gene that can be expressed as a phenotype elo An allele is a segment...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!