Biology question and answers for November 26, 2023
- Q Your goal is to map three genes G1 G2 and G3 Assume that all three genes are located on the same autosome Gene G1 has two alleles Dominant allele X...
- Q In a given strain of fly you are studying the inheritance of the body color and wing surface that are assumed to be autosomal traits Assume that each trait is...
- Q In sweet peas two genes called A and B control the expression of the purple pigment in the petals This is the pathway White Pigment Enzyme from gene A Blue...
- Q 2 In many mammals including rabbits there is a hair texture known as angora in which the hair is long and soft Angora rabbits are highly prized for the quality...
- Q 5 In a sequence of double stranded DNA 2 000 000 of the total bases consists of the base T what is the number of base C A 1 000...
- Q 1 The following DNA template indicates the first 7 base pairs for the beta amyloid pro cell membrane of neural cells Complete the double stranded DNA molecule by adding the...
- Q 20 Which one of the following statements does not apply to a prokaryote and its genome a the genetic material is in the form of a DNA histone protein complex...
- Q Which of the following enzymes plays the largest role in error correction during DNA replication helicase b DNA polymerase I c primase d DNA polymerase III e fixase
- Q Unattached earlobes are controlled by a dominant allele E while attached earlobes are controlled by a recessive allele e It a homozygous dominant individual for unattached earlobes mates with a...
- Q 35 2 List what each of the following symbols stands for in human pedigree ii iii and iv 8pts
- Q 1 In Mendelian garden pea experiment yellow seed color Y was dominant and green seed color y was recessive Also in terms of seed texture round seed texture R was...
- Q 36 Use this pedigree chat to answer questions 3 i iii Queen O A B i How many children does this couple Queen and King have ii How many are...
- Q 8 There are three alleles that determine blood type A B and O Examine the illustration which shows all of the alleles for blood type in the gene pool of...
- Q 5 Use an example to describe how an internal or external environmental factor can affect the way genes are expressed in the cells of a developing embryo Include a description...
- Q 4 Describe the regulation of gene expression in prokaryotic and eukaryotic cells a Describe how gene expression is regulated in prokaryotes in response to a change in their environment such...
- Q 2 Protein synthesis has two main steps transcription and translation a How is RNA polymerase involved in transcription 1 point b Identify the three types of RNA shown in the...
- Q DNA mRNA A U GAC GUA UG CA tRNA TACTGCATA C GT amino acids UAC UGC AUA CGU Tyrosine Cytosine Isoleucine Arginine 3 2 pts Indicate the codons and anticodons...
- Q Q5 7 In a population where the proportion of individuals who are susceptible to malaria genotype HbA HbA is 0 53 and the population is assumed to be at Hardy...
- Q Great white shark outgroup Midas cichlid S American Jungfish W Indian coelacanth Western clawed frog CCTTT CO33Q 0000 Use the molecular DNA data in the table to answer the following...
- Q Draw a model to explain how the boys in the video and anyone with DMD acquired it and how this relates to their physical symptoms HINT looking to see how...
- Q DNA Replication Worksheet Use the diagram to answer the questions to the right 7 9666 The diagrams below show the steps of DNA replication Put the steps in order 1...
- Q Use the following passage to answer the next It has been hypothogina
- Q A blue eyed man 1 whose parents were brown eyed 2 3 marries a brown eyed woman 4 whose father was brown eyed 5 and whose mother was blue eyed...
- Q 1 Predict the offspring when two pink Four o clock flowers are crossed a Complete a Punnett square for this cross b What is the predicted genotypic ratio for the...
- Q 1 In pea plants the round seed allele is dominant over the wrinkled seed allele and the yellow seed allele is dominant over the green seed allele The genes for...
- Q Examine the following pedigree chart of color blindness In humans color blindness is caused by a recessive sex linked allele On the diagram label the genotypes of the individuals 1...
- Q Suppose a newborn baby was accidentally mixed up in the hospital In an effort to determine the parents of the baby the blood types of the baby and two sets...
- Q allele codes for brown coloring The Wallele codes for white coloring The B2 allele codes for black coloring Examine the illustration of the gene pool for a population of this...
- Q 3 A population has the following genotypic distribution Genotype Number of individuals TT 24 Tt 78 tt 15 a What is the total number of allele copies in the population...
- Q 1 Relate alleles to genetic variation and gene pools a How does the number of alleles for each gene in a population relate to the population s genetic variation 2...
- Q This graph shows the heights of 50 17 year old male students Heights were recorded to the nearest centimeter cm Heights of Male Students Number of students 8642 NO 18...
- Q A certain gene in a tree species determines how long it takes for a seed to germinate In one population the alleles for this gene are T1 T2 and T3...
- Q You are part of a team of scientists that is working to characterize new flowering plants You are specifically interested in whether these plants are eudicots or monocots Check all...
- Q oil alall Auflab 3 How does initial allele frequency affect the chances of that allele being lost or fixed by genetic drift 30 olm mit Set up driftR with zero...
- Q age however the couple decided to have genetic tests done to know if their child might be afflicted with a genetic condition Among the various tests karyotypes of somatic cells...
- Q Now complete the Punnett Squares below to show the two possible genetic crosses for the parents shown above and the possible offspring they could produce Use IA IB and i...
- Q 1 0 5 point Color blindness b is a recessive trait located on the X chromosome for sex First give the genotypes that are associated with each phenotype Use the...
- Q Unit 1 Essential Question Why is it possible for two genetically related people to have different phenotypes such as skim color or genetic disorder
- Q If a DNA strand contains the sequence 5 ATTCCGGATCGA 3 which of the following is the sequence of the complementary strand of DNA 5 TCGATCCGGAAT 3 O 5 TAAGGCCTAGCT 3...
- Q Continue clicking through to learn about pigeons the breeds and their heritable traits Listen carefully to the segment on the sex chromosomes for the pigeon 18 What is the genotype...
- Q 11 Copy the sequence of mRNA codons you determined in Step 1 into the table below Then use the mRNA codon table to determine the corresponding sequence of amino acids...
- Q Use the space provi and anyone with D 1 How does somed person s parents or
- Q Christie s Phenotype Blue eyes blonde hair Free ear lobes mid digit hair roll tongue Eye Color Christie s Genotype bb hh EE DD TT Mid Digit Hair Joe s...
- Q Name Match the Parents with the Children You will meet four sets of parents who are missing their children Using the characteristics listed below you will match the children to...
- Q ATGACGGATCAGCCTCAATACGAATTGGCGTTTAAGGCGGATGCGCCGTAA 1 Write the sequence of the mRNA for the Mutant 3 strain 2 Write the amino acid sequence of the polypeptide that corresponds to the Mutant 3 strain 3...
- Q What is one weakness in the theory that a nucleic acid was the hereditary molecule in the first protocells There are no nucleic acids with catalytic activity Complete nucleotide monomers...
- Q In humans free earlobes are dominant to attached ear lobes What would the phenotypes and genotype of the offspring be if a homozygous free eared person mated with a homozygous...
- Q Indicate whether each of the following descriptions better applies to cDNA C genomic DNA G or both B Your answer would be a five letter string composed of letters C...
- Q Biology I Cells Molecular Biology and Genetics ein that is normally localized to the nucleus The und inserted within the nuclear membrane ted to change except the protein sequence reted
- Q In prokaryotes how many molecules of ATP can be generated from the complete oxidation of glucose to CO and H 0 2 38 4 36
- Q Mutated DNA sequence TACCCAGCTTGCGTGGATC mRNA sequence AUGGGOL GAAC GC ACCUAG Amino acid sequence Met GY Arg Thritis Stop 1 What type of mutation is this 2 What is the result...
- Q BLEM 7 following sequence shows the wild type mRNA of a
- Q Directions Transcribe and translate the following strands of DNA to find the mutat the mutation in each mutated sequence Part I Original Wild Type DNA sequence Original DNA sequence TACCCACTTGCGTGGATC...
- Q 11 In cats the allele for a solid fur color F is dominant over the allele for spotted fur Some cats exhibit an extra toe on each paw This condition...
- Q 7 Huntington s disease is a dominant condition that affects areas of the brain People generally start experiencing symptoms in their 30s or 40s a Identify one question you could...
- Q a Describe one early idea about heredity that was shown to be false by Frederick Griffith s research with pneumococci bacteria 1 point b Griffith studied two strains of bacteria...
- Q Use Scenario II to answer the following questions Scenario II R red eyes and r sepia eyes W normal wings w dumpy wings 1 If the male has sepia eyes...
- Q In cats short hair is dominant over long hair A cat with a heterozygous genotype for hair length is crossed with a cat with a homozygous recessive genotype What is...
- Q Which two selections correctly pair a term with an example D 4411 BEANSTORM s TEGREY BERE 2010G BEARI BEART Ste IEE CO BEGELEI POPATS PREP 6980441 2009 PALLADI TOEGERUS Hendr...
- Q Consider the following DNA sequences for four different species 1 AATCG 2 TAATG 3 ATACC 4 ATAGG Based on the principle of parsimony which species shares a most recent common...
- Q UNIT3 GENETICS STEP 1 Determine what kind of problem you are trying to solve STEP 2 Determine letters you will use to specify traits STEP 3 Determine parent s genotypes...
- Q 6 If RR Rr right handed and rr left handed Use the Punnett square to cross a handed dad with a heterozygous right handed mom What are the chances of...
- Q dward go V VI genotype of Beatrice Queen Victoria Leopold Leopold s daughter If Leopold married a non carrier what are the chances of Leopold having a hemophilic daughter Hemophilic...
- Q 11 if 68 black BW speckled WW white Use the punnett square to cross a white and a black chicken What are the chances of having white offspring 12 Define...
- Q For each question make sur Square AND answer the c 1 Long tails are dominant to short Two dogs with heter estimated amount of the offspring having long tails W
- Q Tim and Stephanie from 2 are pregnam againt This time with a baby girl They are servous that she too may get hemophia Based on what you know about Tim...
- Q 9 In a pedigree display you see a symbol shaped like a diamond This symbol means that a the individual has won the lottery and is now wealthy b the...
- Q 1 Assume that the R allele in tomatoes causes red coloration and r r have yellow coloration Furthermore red color has 75 penetrance Two heterozygous plants are crossed and the...
- Q 19 A hypothetical skeletal defect in legs of a certain breed of cats is due to a recessive mutation with only 80 penetrance In the kittens produced in crosses between...
- Q 13 It two poodles are heterozygous for the recessive mutation causing wrinked fur what is the probability that their litter of five baby poodles will include only one with wrinked...
- Q 6 Using what you learned regarding the mathematically combined for dihybrid crosses apply the logic to a trihybrid cross cross of three traits A B and C where one parent...
- Q 8 How many individuals out of the 64 do you predict have the A phenotype the b phenotype and the C phenotype
- Q Below 1ozygous parents AABB xa from P to F Meme Note how the P individuals can each only produce one type of gam te thus all F offs are heterozygous...
- Q Read the following passage adapted from Wikipedia The credibility of DNA profiling a technique used by forensic scientists to assist in the identification of individuals has taken a severe beating...
- Q Teaching Retrieved from https www edutopia org topic culturally responsive teaching Provide a brief summary of the video 2 3 takeaways and any other relevant information that stood out to...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!