Biology question and answers for November 20, 2023
- Q Is the following statement true or false The expression of constitutively expressed genes example enzymes in the glycolysis pathway are not regulated by proteins called repressors and activators that interact...
- Q Which of the following statements concerning E coli polymerase I and polymerase III are incorrect select all that apply DNA polymerase III is more highly processive than DNA polymerase I...
- Q Phenylketonuria is a genetic disease in which individuals are unable to metabolize which amino acid Threonine O Phenylalanine Tyrosine Glutamine
- Q 1 The following nucleotide sequence is found on the template strand of DNA in the protein coding region of a eukaryotic gene 3 TAC ACG GCT CCA TGT ATT 5...
- Q syndrome Directions Step 1 Make a TEMPLATE DNA Strand Step 2 Show the sequence of the mRNA from the TEMPLATE DNA using the mRNA base pairing rules Step 3 Name...
- Q Question 38 If one strand of a DNA molecule has the sequence ATTGCA the other strand would have the sequence O UAACGU O TUUCGU O TAACGT O TUUGCT O TAAGCT...
- Q Expression of NGN2 TH auced pluripotent cells causes the cells to have transcriptiona profiles that mark them as mainly glial cells Some cells similar to central nervous system neurons some...
- Q exons of a gene found in five different eukaryotic species Each part is numbered to indicate its distance from the promoter for example intron I is the one closest to...
- Q p repressible operon q lac operon of E coli lacZ lacY lacA structural genes r Cap site lacP laco s Lac repressor Lacl t CAP u cAMP vs glucose v...
- Q Home 30 a During which stage of Translation does the mRNA molecule attach to the small ribosome subuni O Termination Ob Intation Oc Polyemization Od Bongation Energy cannot be created...
- Q apiens uploM UN 5 Use the genetic code table Which amino acid is coded for by only one codon sequence a b C d e a b serine threonine isoleucine...
- Q M 12 Breaks hydrogen bands resulting in th formation of areplication fork during the process of DNA replication bi coronase TB RNA polymerase C Helicase D DNA polymcrose
- Q Determining the exact sequence of a gene would be whether a trait is inherited in a dominant vs recessive pattern would be O Transmission Population O Molecular Population Physiological Transmission...
- Q Edit View Insert Format Tools Table 12pt P nonsense G sense aph v There are four possible results from a mutation missense BIU AT V
- Q What do you notice about the orientation of the left strand compared to the right strand
- Q If a researcher is examining cells from a breast tumor biopsy which of the following microarray assay DNA chip outcomes would best support a diagnosis that the tumor is cancerous...
- Q During the elongation phase of translation which site in the ribosome represents the first location where a codon pairs with an anticodon O the large ribosomal subunit OP site A...
- Q 5 If the following mutations would occur in the coding region of a gene which is the least likely to cause a structural or functional change in the protein that...
- Q Which of the following statements are true Mark any or all that apply In reverse genetics the DNA sequence of a gene is known before mutations in that gene are...
- Q Define the following a Gene expression b Constitutive expression c Positive regulation d Negative regulation e Regulatory element f Regulatory protein g DNA binding domain
- Q 0 00 0 00 A C B BB 6906 B B b b RTY Speed 1x the genes of every elephant in the world all of the genes of elephants...
- Q repressor i activator j allosteric protein k inducer 1 corepressor m operon n operator
- Q Rosalind Franklin s x ray diffraction images taken in the 1950s most directly support which of the following claims about DNA I A The ratios of base pairs are constant...
- Q Home 41 p 42 hard Student Resou In a population of deer females are most attracted to males with the largest antlers so those ma frequently Over many generations the...
- Q A reverse transcribing DNA virus in Baltimore group VII must first convert the dsDNA to of the dsDNA genome single stranded DNA double stranded DNA double stranded RNA single stranded...
- Q 21 For E coli strains with the following lac genotypes and genotypes on the next page use a plus sign to indicate the synthesis of galactosidase and permease and a...
- Q the DNA sequence below to answer the following questions vena horla 8 noiloo2 5 bns beylovni me 1 mark i ii iii 3 TACGAACGAGTGCCCCAAAATT polo What is the complementary DNA...
- Q How does the data support the hypothesis that DNA not proteins is the ansforming principle
- Q 15 A mutation prevents the catabolite activator protein CAP from binding to the promoter in the lac operon What will the effect of this mutation be on the transcription of...
- Q 14 During DNA replication one of the new strands of DNA is synthesized continuously while the other is synthesized as a number of separate fragments of DNA that are subsequently...
- Q 9 RNA polymerase participates in DNA replication RNA replication DNA transcription a b C d RNA transcription e RNA translation
- Q and to rok Goods an red of bus por any poporop Sy he go up by ssawed off b ST
- Q Match the terms with their descriptions Antiparallel Complementary Replication Semi conservative Sequence Template Choose Choose The process of copying DNA This is the strand of DNA that is used as...
- Q 7 What is the function of DNA polymerase in DNA replication a enhub C d e AU all of the above a b to create replication bubbles by unravelling the...
- Q SCENARIO 2 A new house still under construction is vandalized The builders would like to know who may have caused this property damage He hopes there may be fingerprints on...
- Q What are some of the issues of genetic testing What is your opinion on how genetic information should be used Don t forget to expand the discussion with new information...
- Q Exit Ticket 4 0 A 1 Below is a segment of DNA that is ready to be replicated Show the processes that the segment will go through during replication after...
- Q 2 You have sampled a population in which you know that the percentage of the homozygous recessive genotype aa is 36 Using that 36 calculate the following A The frequency...
- Q Multicellular organisms have different cell types because of gene regulation Which statements are true depictions of how human gene regulation works Check All That Apply Genes transcribed only in lung...
- Q Determine whether each of the following mutations has severe effects mild effects or no effects at all a Nonconservative missense mutations not in the active site of a protein b...
- Q 12pt V Paragraph V BI 4 themes of gene expression Epigenetic Transcriptional IC
- Q RNA molecule has three potential reading frames while a double stranded DNA molecule has six potential reading frames O True O False
- Q The sequence of RNA processing changes a primary transcript synthesized by RNA polymerase into a mature mRNA These processing steps include i addition of a run of As a poly...
- Q Degeneracy because a 1 amino acid 1 codon 1 tRNA relationship does not exist O True O False
- Q Wobble describes how the anticodon of a single tRNA species can base pair with several different codons for the same amino acid O True O False
- Q same region of a gene isolated from three independent mutants are given below Pink Mutant 5 ACCGTAATCGACTGGTAAACTTTGCGCG 3 Green Mutant 5 ACCGTAGTCGACCGGTAAACTTTGCGCG 3 Blue Mutant 5 ACCGTAGTCGACTGGTTAACTTTGCGCG 3
- Q State four 4 themes of gene expression Edit View Insert Format Tools Table T A
- Q 4 When would an insertion or deletion mutation NOT result in a frameshift mutation Think of at least 2 different cases
- Q 6 What did the DNA look like Does this match your prediction
- Q Five COVID 19 mutants were identified that did not attach to epithelial cell membranes Complementation testing of the five 5 mutants was performed and yielded the following results 1 2...
- Q 4 There is a special type of RNA called siRNA silencing RNA that can complementarily bind to an mRNA transcript and create a short double stranded segment of RNA This...
- Q What is the biggest disadvantage of having a degenerate genetic code Mutations are more likely to alter the amino acid sequence of proteins causing deleterious consequences to the organism Mutations...
- Q Peptidyl transferase within the ribosome forms covalent bonds between amino acids O True False
- Q Which of the following is translated in the rough ER Glycogen phosphorylase Protein kinase A OG proteins Growth factors
- Q Imagine that you repeat the Benzer tRNA Selection experiment with modifications as follows 1 Synthesize mRNA containing U s and C s only poly UC in random order 2 Convert...
- Q Mutant trp 1 trp 2 trp 3 trp 4 trp 6 trp 7 trp 8 trp 9 trp 10 Minimal medium Anthranilic acid 1 1 1 T Indole glycerol phosphate...
- Q C B D AGA E AO 36 template DNA strand GG PPS F H CC cell What is this location 77 What is the specific name of the entire molecule...
- Q 2 Suppose the following sequence is found in mRNA 5 AUGCAGUGCUUUUGA 3 a Given that the AUG is a start codon draw a box around each codon in this sequence...
- Q 4 Sketch a double stranded region of bacterial DNA and the mRNA transcribed from the information in this DNA Label the following on your diagrams and state the importance of...
- Q 75 If a mother is a carrier for a sex linked gene and the father expresses the recessive sex linked trait then there is a 50 chance that their daughter...
- Q C B 1 point Use the mRNA codon chart below to assign amino acids to the following mRNA sequence You may use the single letter abbreviations assume a start has...
- Q 67 In which specific part of the female reproductive system would you find the process of fertilization taking place 68 Two homologous chromosomes will have the same locus for a...
- Q How can databases of variants be used to help pinpoint a disease causing mutation Check All That Apply Some amino acids are conserved in genes across species mutations in conserved...
- Q 2 The following diagram illustrates a step in the process of translation Identify the following elements on the diagram fMet pro UAC GGG AUGCCCACG UAG
- Q In order to learn about the function of a gene scientists sometimes use a transgene to express the gene ectopically in the wrong place For example the fruit fly gene...
- Q 64 The allele for six fingers A is dominant over the allele for five fingers a What is the probability that two people who are heterozygous for this trait will...
- Q Which of the following would be useful for monitoring the location of the gene X protein product protein X in an organism Check all that apply Check All That Apply...
- Q Recall that sgRNAs for CRISPR Cas9 have a 20 nt sequence that is identical or nearly identical to a 20 bp sequence in the genome you want to modify Recall...
- Q 56 In which phase of mitosis would you find chromosomes loosening into their chromatin form 57 To what part of a chromosome does the spindle fiber attach
- Q During lysogeny an inactive prophage state occurs when the viral DNA is inserted into the host chromosome host nucleolus host cytoplasm host nucleus host cell membrane
- Q Biology Suppose that recessive deleterious allele is found to be much less common than its predicted equilibrium frequency based on the selection coefficient and mutation rate measured in modern populations...
- Q Directions Complete this concept map by choosing terms from the word bark and writing them in the correct spaces amino acids DNA instructions nucleic acid proteins RNA transcription units 2...
- Q Which of these statements will corroborate confirm known information about transcription OARNA polymerase holoenzyme composes of five subunits that drive transcription in E col OB RNA transcription in bacterial and...
- Q The astronaut Scott Kelly just returned to Earth after spending one year on the International Space Station NASA scientists wanted to know how life in space affects gene expression They...
- Q The nucleotide A B T always pairs with A C G
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!