Biology question and answers for November 14, 2023
- Q In normal, healthy operation of the trp operon, what happens if tryptophan concentrations are high? The repressor binds to the operatorAlternative RNA splicing is activatedPost-translational modification occursTryptophan binds to RNA...
- Q A) Using Lambda phage as an example, what is the difference between a lytic cycle and a lysogenic cycle in bacteriophage biology?B) Under what circumstances might this phage switch from...
- Q In Eukaryotic gene regulation, which of the following can increase gene expression?enzymes removing the 5' cap on mRNAblocking ribosomes from attaching to mRNArepressors binding to the control elementsenzymes tagging proteins...
- Q In C3 photosynthesis, the first step of the Calvin cycle occurs when CO? combines with in a reaction catalyzed by the enzyme Rubisco.1.3 bisphosphoglycerateGlyceraldehyde 3-phosphate2-phosphoenobbyruvateRibulose 1.5-bisphosphate3-phosphoglycerate
- Q Very often an organism's traits are caused by a combination of its genes and its environment. Think about the green color you saw in the genetically transformed bacteria: a. What...
- Q With respect to DNA replication you should know the followingNames of all the enzymes involved in DNA replication and their functionWhat is origin of replication and what is the meaning...
- Q Which of the following statements is TRUE?RNA polymerase Ill synthesizes tRNAInsertion mutations replaces a base pair for anotherAAUAAA is an Eukaryotic promoter sequencetRNA carrying the next amino acid enters the...
- Q Use the space provided to answer the questions and draw a model to explain how the boys in the video (and anyone with DMD) acquired it and how this relates...
- Q An individual is found to have an inherited mutation in a gene associated with breast cancer. In which cells is this form of the gene located?Only in the cells of...
- Q What is the relationship among genes, DNA, and chromosomes? Genes are composed of DNA and lie within chromosomes. Genes are found only in chromosomes and not DNA. Genes are found...
- Q In the DNA sequence 5'-ACTG-3', the phosphodiester linkage between the cytosine and the thymine connects:O the 3' end of the thymine to the 5' end of the cytosine.O the 3'...
- Q For the numbered steps below, place them in the correct order from start to finish.1) The ribosome binds to the mRNA and uses tRNAs to translate mRNA into the corresponding...
- Q A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe- ser-pro-phe-arg. a Postulate a base sequence in mRNA that would direct the synthesis of this hormone. Include an...
- Q What repair system is used to fix DNA damage such as thymine dimers?nucleotide excision repairnon-sister chromatid repairmutation repairmismatch repairbroken strand repair
- Q Match the following terms.DNA synthesis using complementary base pairing. Copying the DNA prior to cell division. gene expressionCreating a complementary RNA molecule using one side of the DNA as a...
- Q Sickle Cell Anemia (SCA) is a genetic anomaly that causes blood vessels to sickle when under oxygen stress. These sickled cells can get stuck in the capillaries of the body,...
- Q Translate the following RNA sequences into an Amino Acid sequence.1) CUU-CCU-GCG 2)UUA-CCC-GCCWhat do you notice about the 2 Amino Acid sequences?A. NothingB. The 2 different RNA sequences code for...
- Q Given the DNA sequence below, transcribe and translate it into an Amino Acid sequence.TAC GTA TCG ACAMethionine-Histidine-Serine-CysteineHistidine-Cysteine-Serine-MethionineCysteine-Serine-Methionine-HistidineSerine-Methionine-Cysteine-Histidine
- Q Environmental factors typically activate genes in a cell by causing the cell to -A produce identical daughter cells through mitosisB form haploid gamete cells through meiosisC fuse with another cell...
- Q ...radiation excites atoms to a higher energy state within molecules such as DNA that then leads to the formation of pyrimidine dimers.InfraredUltravioletGammaParticlelonizing
- Q 35) The human genome project is dedicated to the sequencing of the human genetic code. Some people are opposed to sequencing the genomes of individuals, for privacy, among otherreasons.However, there...
- Q Which of the following is NOT a feature of DNA replication?each chromosome has one origin of replicationreplication bubbles spread in two directionsa new strand is synthesized using an old one...
- Q The cars of Arnett, Bradley, Church, and Dawson are gray, red, silver, and yellow. Bradley and Church had lunch yesterday with the owner of the silver car. Dawson saw the...
- Q c. One genetic change associated with the disorder results in a methionine-to-valine substitution at amino acid position 425 of the encoded polypeptide. Using your codon table predict a DNA point...
- Q Referring to the template DNA sequence below, if DNA polymerase III moves from left to right across the paper, what would bethe sequence of the leading daughter strand synthesized?5' ACGTCTGGAACTCGT...
- Q Imagine that a DNA sequence of A-C-G-T-A-C-G-T is altered to A-C-G-A-C-G-T. This could have happened as a result of a(an) mutation.PointTranslocationDeletionInsertion
- Q The two strands of the DNA molecule areantiparallelalternating palindromicidenticalparallel
- Q DNA polymeraserequires a template for the synthesis of DNAcan add nucleotides in two different directionsfills in gaps in DNAcan work with both single-stranded and double-stranded DNA
- Q When a repressor binds to the operator site on DNA,it blocks RNA polymerase and mRNA synthesisit links adjacent thymines and alters DNA foldingit prevents the binding of the substrate to...
- Q 6. Before an activator can bind to DNA,it must react with the substrate it regulatesthe two strands of DNA must separateit must be released from the repressor part of the...
- Q A trait undergoing directional selection will increase in overall variation from one generation to the next.TrueFalse
- Q 1. DNA replicates in a ______ mode2. In the DNA given below which is the coding strand and which is the template strand. What is the difference between the two?
- Q Transcribe and translate the DNA given below. Given below is the coding strand.5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 3'
- Q Given below is the anticodon in a tRNA. What amino acid does this tRNA code for?5' CAU 3'
- Q 1. Transcribe and translate the DNA given below. Given below is the coding strand.5'ACCTACCCATGCTCGATAAATGAAGTTCATTTTGACAAGAC 32. Given below is the anticodon in a tRNA. What amino acid does this tRNA code...
- Q 22. Given below is a sequence 5' ATGGTAGGGG GTATTAAATC CAGTTATCAG AGGATCGGGA CCGAATAGGT 3' a. Is this an mRNA or DNA sequence. How can you tell? b. If the 8th G...
- Q An antibiotic that interferes with the structure or function of (the)O cell wallO DNAO RNAO cell membraneO proteinwould be most likely to have serious side effects.
- Q Which of the following mutation is likely to be the most lethal form?back mutationmissense mutationsilent mutationnonsense mutationviruses
- Q 4a) In watermelon, fruit shape may be short or long, color may be striped or green. A homozygous long, green melon was crossed with a homozygous short, striped variety. The...
- Q DNA fingerprinting is used toa. Amplify DNAb. Silence genesc. Identify pathogensd. genetically modify crops
- Q A targeted and specific change in a gene isa. DNA fingerprintingb. Mutationc. Colony hybridizationd. Site directed mutagenesis
- Q Which of the following statements are true?Transcription occurs in the nucleolus and translation occurs in the nucleus.Transcription and translation both occur in the nucleus.Transcription and translation both occur in the...
- Q In what cellular location is ribosomal RNA (rRNA) produced?O NucleolusO Endoplasmic reticulumO Nuclear poreChloroplast
- Q Translation of new proteins occurs in the nucleus.O TrueO False
- Q During protein production, what is the name of the process in which RNA is used to make protein?ReplicationTranscriptionTranslationExocytosis
- Q If you removed the promoter from a gene, what problem would that cause?A. RNA polymerase would transcribe the gene in the wrong direction.B. RNA polymerase wouldn't be able to add...
- Q Which of the following can lead to a change in genetic information?ConjugationMutationsall of these are correctlonizing radiationTransformation
- Q Which of the following parts of a gene is present in the primary transcript but NOT in the mRNA?A. exonB. start codonC. promotorD. intronE. UTR
- Q A stop codon isA. UGAB. UGGC. AUGD. UUA
- Q At the start of the citric acid cycle, acetyl CoA combines with ___A. malateB. oxaloacetateC. citrateD. pyruvate
- Q Enter the corresponding mRNA segment to the BRACA1 gene.Enter the nucleotide sequence using capitalized abbreviations.5' ___3'
- Q The complementary mRNA template for the following DNA strand is3'-CCAGGCAAC-5'A. 3-GGUCCGUUG-5'B. 5'-GGTCCGTTG-3'C. 5'-UUGAAUGGU-3'D. 5'-GGUCCGUUG-3'
- Q What did the researchers find in their study of the various breeding display of Birds of Paradise Species that display on the ground have more dance moves that those displaying...
- Q Which of these best describes a gene O O O a segment of DNA that codes for a protein a protein that determines a trait a product of cell division...
- Q Which statement gives an example that best demonstrates how the geosphere has affected the evolution of life on Earth OB OC OA Some hummingbirds have evolved to have very long...
- Q Why can DNA be used to determine phylogeny OA DNA sequences change as species evolve so comparing sequences from different species helps determine how closely related they are B Organisms...
- Q Researchers at Princeton University and their students have studied the medium ground finch Geospiza fortis on a tiny island in the center of the Galapagos Islands for many years To...
- Q Derived characters are traits O that originated in a common ancestor O that are shared by all species O found in distantly related species found in closely related species
- Q Darwin s main contribution to our understanding of speciation is TURNER O beneficial inherited traits have selective advantage variation in populations are necessary for evolution by natural selection common descent...
- Q The theory of evolution is consistent with evidence of which of the following O fossil record O molecular genetics O biogeography O all of the other answers homologous structures
- Q Organisms are adapted to their environments due to O changes in the environment that accommodate the organisms set of traits O artificial selection and selective breeding O acquired traits that...
- Q A population is said to be in an equilibrium no change in allele frequency if all of the following conditions are met EXCEPT Ono mutation no migration O random mating...
- Q c 2500 B C E c 1400 B C E Located on island of Crete Capital at Knossos Traded on the Mediterranean Aegean Known for beautiful frescoes
- Q While in the seventeenth century the Navigation Acts were directed primarily at commerce and trade by the eighteenth century the Navigation Acts began to focus more on manufactures True False
- Q During the eighteenth century British imperial policy changed to keep pace with the social political and economic changes taking place in the colonies True O False
- Q throu meiosis The chromosome s color shows which parent they came from and their length shows which chromosomes are homologous Which picture most accurately shows this cell during metaphase I...
- Q One of the fruit fly crosses in Lab 11 was wingless females x white eyed males In this question you will diagram the reciprocal cross white eyed females x wingless...
- Q b These images show the embryos of vertebrates at early stages of development Identify similarities among these different species and explain how the similarities provide support for the theory of...
- Q In Natural Selection adaptation refers to 1 Point O learned behaviors that increase an organism s chances of survival O inherited characteristics that increase an organism s chance of survival...
- Q Species 1 modern whales Species 2 Pakicetus Species 3 Dorudon Species 4 Rodhocetus Species 5 Ambulocetus b Draw a concept map in the space below 2 points i Show the...
- Q Species 1 Pakicetus Species 2 Ambulocetus Species 3 Rodhocetus Species 4 Dorudon Species 5 Modern whale ii Label a species with a vestigial structure and the species with the ance...
- Q 6 Suppose a drought caused the local extinction of all insects slugs and clams This allowed the drought resistant deep stick bug to grow in their absence which lives 12...
- Q Drag each tile to the correct star Not all tiles will be used Identify the element present in each star based on the gaps observed in the wavelengths of its...
- Q III How adaptations become common in a population Morgan s sphinx moth or Xanthopan morganii is a moth found in Madagascar that has a long proboscis The Morgan sphinx moth...
- Q If we started the process of evolution over again on Earth would all of the organisms still evolve and look the same or would the process give us completely different...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!