Biology question and answers for December 26, 2023
- Q it throughout the school year It s contain important ideas and activities that provide families and children with knowledge about becoming and staying healthy and fit These bags allow family...
- Q 2 Below is epehdrine metabolism On each arrow write the name of the enzyme responsible for th catalytic reaction HO NH Norephedrine OH CH NH 4 Hydroxynorephedrine CONHCH COOH Hippuric...
- Q Use the Background information from the article to help you identify what is happening as rock undergoes changes Write the number from the diagram in the blanks to describe the...
- Q What do you think you would like to do after high school What skills are important to hone while in high school to prepare for your planned future What are...
- Q The passage discusses the importance of the discovery of the structure of the DNA molecule What did this discovery allow scientists to confirm O Specific base pairing allowed DNA to...
- Q 2 What are six signs of a chemical change 3 State whether the items below are physical or chemical changes Popsicle melting Sodium reacting with water and chlorine Folding paper...
- Q 37 Base your answer to the following question on the information below and on your knowledge of biology In a test for diabetes blood samples were taken from an individual...
- Q 8 45 01 24 38 lodine is the decolorizer in the Gram stain True or False True False Help S
- Q Discussion Topic Viruses and bacteria can infect human cells Bacteria are living organisms while viruses are not How do you think the treatment for viral and bacterial illnesses differ How...
- Q 2 Scientists often work together with other scientists If you were working in a scientific laboratory how could you help people in your laboratory work together in a way that...
- Q SE2 Describe insulin biogenesis from translation to secretion Insulin biogenesis from translation to secretion
- Q Incorporation of A ATP B dCTP C ddTTP PLASTP Put Name on Paper would result in chain termination during Sanger DNA sequencing
- Q 24 A ligand that resembles substrate affects catalysis by A noncompetitive B competitive C uncompetitive D irreversible E irretrievable inhibition
- Q E TBP and TFIIB 10 A biomolecule or macromolecular assembly can be sedimented to equilibrium t A CAT scan B X ray diffraction crystallography C mri D mass spectrometry E...
- Q 14 In the PDH reaction acetate is accepted by A OAA B 3 OH C S CoA D FAD E Niacin
- Q 17 The translocation step in translation depends foremost upon A a termination tRNA acylated to an amino acid B a chain terminating RT inhibitor C elongation factor G D fMet...
- Q 4 The class of RNA most directly involved in translational decoding is A TRNA B miRNA C snoRNA D siRNA FloRNA
- Q An amino acid in a core histone protein which electrostatically bonds nucleosome subject to acetylation is A Trp B Lys C lle D Pro E Gln
- Q 2 Pyruvate is converted to A CO and ethanol B propionate C succinyl CoA D lactate E alanine under anaerobic conditions in mammalian anacrobiosis
- Q 1 The pathway that produces ribose from glucose is A glycogenesis B glycogenolysis C glycolysis D pentose phosphate pathway E gluconeogenesis
- Q Is this secondary xylem or secondary phloem Early wood vessel Hardwood or softwood Is this secondary xylem or secondary phloem Choose Choose
- Q to your previous tests 33 questions x 2 embedded questions 66 points Question 87 In the Introduction to Food Macromolecules lab simulation you learned that contains lots of carbohydrates O...
- Q Which has NOT been used as a cognitive behavioral treatment for Alzheimer s disease Odoing simple math and reading aloud in a group setting increasing the capacity of short term...
- Q One symptom of Brianna s borderline personality disorder is a disorganized attachment style What does this mean She has difficulty identifying and controlling her emotions Her relationships with other people...
- Q Here is part of a gene 3 GTAACCGTATTGCAGCTATTAGCAGC 5 CATTGGCATAACGTCGATAATCGTCG If the bottom strand of the DNA carries the gene write the mRNA that would be transcribed from this section...
- Q A hominin with an orthognathic face a chin and a forehead would be considered which species Homo neanderthalensis O Homo habilis O Homo erectus O Homo sapiens O Homo rudolfensis
- Q When transferring culture to agar plates it is OK to have the plate uncovered for as long as you want because this will not interfere with your results O True...
- Q There are two general types of endoscopes they ar O Rectal and Oral Diurnal and Nocturnal O Robust and Fragile Flexible and rigid
- Q The intermediate shown converts a ketone or aldehyde into what functional group Ph Ph Ph organophosphane O O alkene O alkyne 1 2 di ketone
- Q 19 2 points Botulinum toxin Botox is a neurotoxin that is produced by several species of bacteria and can cause paralysis Botulinum toxin prevents the synaptic vesicle membrane from fusing...
- Q 6 2 points An example of the quaternary structure of a protein is A Hydrogen bonds between amino acid backbones in an alpha helix B Peptide bonds between amino acids...
- Q 7 2 points The structure of a molecule named estradiol is shown to the right Is estradiol able to pass through the phospholipid bilayer on its own HO H H...
- Q 2 2 points The figure below shows the structure of a biological molecule called ATP Which of the following functional groups is NOT present in this molecule A An amino...
- Q 3 A short polypeptide sequence is shown below with amino acids numbered 1 through 3 from left to right On the image do each of the following HIN CH3 S...
- Q Short Answer 9 Questions Answer the questions in this section as completely and concisely as possible Make sure you answer the question that is being asked Extraneous information unrelated to...
- Q Match each item in the left hand column below with its definition or description in the right hand colum a a diverse group of microscopic organisms most of which are...
- Q specific observations O Inductive Reasoning Drawing Conclusions O Forming a Hypothesis Deductive Reasoning Question 100 are liquid at room temperature O None of these O Unsaturated Fats All Fats 1
- Q a solution to a Hypotonic Isotonic O Hypotonic Hypertonic O Hypertonic Hypotonic Isotonic Hypotonic Question 74 These cut DNA wherever a specific nucleotide sequence occurs O Restriction Enzymes O Primers...
- Q s in hydrake lipids 8 9 Period Part A Identify the specific molecule use the above terms from each description Some terms may be used more than once 13 2...
- Q 27 What is the purpose of detergent dish soap in extracting DNA from strawberries a It precipitates the DNA from the fruit juice b It breaks down the phospholipid bilayer...
- Q 16 This phase of mitosis is the longest phase where chromosomes appear under a microscop a prophase b prometaphase c metaphase d telophase
- Q How knowledge of macromolecule structure could translate to the knowledge of immune factors
- Q 5 CTP is a n A uncompetitive B allosteric C irreversible D mixed E competitive inhibitor of aspartate transcarbamoylase
- Q The following image shows the results of electtrophoresis of two samples A and B The DNA samples were placed in the wells at the top and the electrical current was...
- Q What type of change in chromosome structure is being depicted in the image K X XX Duplication Insertion Translocation Inversion Deletion
- Q O DNA A T G C ORNA sugar is ribose O DNA uses Uracil instead of Thymine O RNA is single stranded Question 79 Polysaccharides are large chains of sugar...
- Q In the 1300s Europeans believed a way through spiritual beings O Higher Ranking Order O Organismal Leveling O Line of Existence Great Chain of Being existed which extended from the...
- Q 1 Enzyme names end in what 2 How do enzymes speed up reaction rates 3 What is allosteric inhibition vs competitive inhibition 4 How does concentration of substrate and product...
- Q 1 Compare positive and negative feedback mechanisms Which are more common 2 How do bacterial cells communicate 3 What are the different stages of the cell cycle what goes on...
- Q 6 What nucleotides are found in RNA vs DNA ginge
- Q What is the proper way one protein bonds to another How does this give it directionality
- Q 1 What are primary secondary tertiary and quaternary protein structures What happens when the protein is somehow changed 2 What type of molecule is show below Label the functional groups...
- Q A poison is released into the environment that disrupts the activity of NADH Reductase, an enzyme found in the ETC of the mitochondria. What would be the effect of such...
- Q Protein synthesis links individual bonds together by a condensation reaction. Thisreaction decreases entropy.TrueFalse
- Q Which body composition modality do you believe is the 'best' to use? In your response, make sure you include testing accuracy, testing cost, ease of access for patients, and ease...
- Q Describe the biochemistry of the protein macromolecule. One of the unifying themes in biology is that structure facilitates function at all levels of organization. Explain how the structure of proteins...
- Q Write in sequence the 8 steps of the citric cycle starting with citric acid and ending with citric acid. Show the structures of the 8 reactants/products and the correct (full)...
- Q 1.a. When the pH=7 the solution is ___, where the number ofhydrogen ions and base (OH-) ions are equal. 1.b. A solution with a pH less than 7 is ___,...
- Q Why must some of your DNA be replicated in fragments? Please do not focus on HOW the DNA is replicated-tell me WHY some of it must be replicated in fragments.
- Q Which of the following types of covalent bonds are found in the structure of ATP?N-glycosidic, thioester, phosphodiester bond.Ester, ether, phosphoanhydride bondPhosphoanhydride, phosphomonoester, N-glycosidic bond.Ether, ester, phosphomonoester bond
- Q Which of the following is not a mechanism of horizontal gene transfer?TransductionConjugationTransformationSpontaneous mutations
- Q The following peptide is cut by serine protease enzyme Trypsin. How many fragments will be produced after trypsin digestion?Val-Ile-Arg-Lys-Leu-Arg-Gly-Ala-Lys-lle0 31095
- Q Discuss the differences between gene point and chromosome mutation in terms of severity, reversibility, condition caused.
- Q Which of the following amino acids will be eluted first if added to a column packed with cation exchange resin?LysineProlineSerineAspartate
- Q ATP is a highly ________ molecule. ATP spontaneously _______ ADP +P?, and the free energy _______ during this process is lost as heat.
- Q is a deadly, colorless, odorless gas that is a by- product of incomplete combustion. A. Sulphur B. Hydrogen Peroxide C. Carbon Monoxide D. Cadmium
- Q Read the following dialogue taken from Chapter 2 of Stories By English Authors of the novel THE BLACK PODLE by F. Anstey, and answer the question that follows."That there's him,"...
- Q What is Direct Input? The process of entering prescription information while the patient remains at the In Window or Drive Thru The process of answering the phones by the...
- Q Choose the correct answer.To _______ is to combine several sources for the purpose of analysis.synthesizeanalyzationreflect
- Q The 2nd Law of Thermodynamic s states that in every energy transformation some energy is lost, usually in the form of A. ions B. heat C. liquids D. plasma
- Q Which of the following molecules would NOT be considered a carbohydrate?glycogenstarchsucrosetriglycerideOfructose
- Q Which are the monomers of proteins?monosaccharidestriglyceridesamino acidsfatty acidsnucleotides
- Q Regarding the DMEPOS Patient Rights and Responsibilities, name three of the rights and three of the responsibilities: Rights: speak to a pharmacist: confidentiality and privacy of all information; be treated...
- Q What is the function of a catalyst?to enhance reaction speedto inhibit a reactionto slow down reaction speedto lower the activation energy of a reactionto shift a reaction to the reactant...
- Q Alpha-ketoglutarate dehydrogenase (an enzyme) is used to test the activity of an unknown compound.Upon exposure to the compound, the enzyme is altered such that all activity is nearly eliminated. The...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!