Biology question and answers for December 20, 2023
- Q Mitochondria originated from proteobacteria 1 True O2 False
- Q In the epiphyseal plate cartilage grows by pushing the epiphysis away from the diaphysis O from the edges inward Oby pulling the diaphysis toward the epiphysis O in a circular...
- Q Which of the following does NOT specifically support of the endosymbiotic theory for the origins of mitochondria and chloroplasts Mitochondria and chloroplasts have double membranes Mitochondria and chloroplasts have circular...
- Q Erobic acterium IND Mitochondrion Modern heterotrophic eukaryote
- Q O pseudopods O cilia fins flagella
- Q Question 4 atch the terms on the left to the correct explanation nzymes
- Q A researcher synthesizes a new molecule called inhibitor X that inhibits the activity of phosphofructokinase PFK the enzyme that phosphorylates fructose 6 phosphate during glycolysis Inhibitor X competes with ATP...
- Q es 2452285 quizzes 5493550 take
- Q Which of the following statements is NOT CONSISTENT with Cell Theory Bacteria and Eukaryotic cells divide using different mechanisms Archaea and Bacteria are structurally similar but Archaea are genetically more...
- Q The cholera toxin produces massive diarrhea and dehydration and possible death if not treated The toxin ultimately affects a chloride channel which is controlled by ATP Activation of the channel...
- Q QUESTION 7 What is the fate of the pyruv O Pyruvate combines with O Pyruvate is reduced to ei O Pyruvate travels to the el
- Q 7 List the nitrogenous base pairings in DNA always pairs with joined by joined by always pairs with bonds bonds
- Q To what category does this amino acid belong Note that the non ionized form is shown H N C C H C OH CH3 H H Opolar uncharged polar negatively...
- Q Insolation 90 75 60 45 30 15 0 15 30 45 60 75 90 Latitude S Equator Latitude N What month do you think this graph represents a December b...
- Q What makes a carb or any other molecule an isomer of another molecule and how does that influence the molecules function
- Q ATGACGGATCAGCCTCAATACGAATT 1 Write the sequence of the mRNA for Mutant 1 2 Write the sequence of the DNA template stran 3 Write the amino acid sequence of the polypept 4...
- Q PROBLEM IV Consider the following karyotype of a specific animal The homologous pairs are grouped together in the picture CHR 30 110 7 18625 THI 3063 D X 95 SH...
- Q O Which types of bridges are present in the protein insulin a tripeptide Ob trisulfide O c dipeptide d disulfide e polypeptide
- Q UESTION 11 ch the description to the component Also called actin filaments Used to help the movement of organelle cell Assist with cell movement associated wi
- Q What is the name of the weak Is this a strong or weak bond What is the name of the bond that holds amino acids together Is this a strong...
- Q 4 Relate DNA replication to how accurate genetic information is passed down through generations a Explain how DNA replication ensures that genetic information is conserved when a parent cell divides...
- Q At which point in the cell cycle does DNA replication take place O A During mitosis OB During G phase OC During S phase OD During G phase
- Q Why is it necessary for meiosis to produce haploid cells rather than diploid cells OA It reduces the chances of genetic variation because there are fewer chromosomes in each gamete...
- Q 1 In human females the development of all potential egg cells is halted during fetal development during which stage of cell division a prophase II b metaphase II c mitosis...
- Q Desertification is the conversion of fertile land into desert What are possible causes for this transformation Select all that may apply Drought Mixing farm crops with native plants Replacing native...
- Q Which of the following BEST characterizes the US Government s perspective on dioxin in Agent Orange during the Vietnam War Secret Operation Ranch Hand documents revealed that the herbicidal mission...
- Q All of the below would be required for induced pluripotent stem cell technology EXCEPT skin or other somatic cells from a patient O culture conditions to prompt differentiation into particular...
- Q Order the steps involved in protein synthesis and transportation Proteins inside of the rough endoplasmic reticulum are either modified with the addition of side chains or undergo proper folding The...
- Q explain the effects of problems with myelin that lead to myelin diseases
- Q explain the passive conductance of an electrical signal across a neuronal membrane
- Q acti TS O Conjugation O Binary fission ge
- Q Using the following diagrams please answer the The following diagram is of a set of human chromosomes This diagram is known as a KARYOTYPE There are several things that can...
- Q Select all that apply Which of the following are characteristics of reproductive isolation There is no gene flow between two groups of organisms species Interbreeding between species occurs It is...
- Q you think that the government or businesses should be he
- Q this cell line significant to research on infectious diseases O HeLa cells provide an unlimited source of human cells because they are immortal O HeLa cells provide an unlimited source...
- Q The following diagram represents the correct answer that completes the sentence Step 5 or Step 4 Olytic cycle Source Biologywise com Release O infection Host Cell AU Assembly lysogenic cycle...
- Q 1 Of the ten stages of genocide identify the steps from the Bosnian genocide and explain their significance
- Q 7 to nd u and your group will need to plan what materials you will need to represent the cell mponents This is your time to be CREATIVE After discussing...
- Q 18 Which step shows a piece of recombinant DNA being inserted into a bacterial cell a 4 b 5 c 6 d 7
- Q Since most bacterial cells have a positive charge we need to use a stain with a charge to stain them
- Q 14 AKS 8a A An from a single cell A clone B transgenic organism C recombinant DNA D bacteriophage is a member of a population of genetically identical cells produc
- Q AKS 8a Select ALL that are examples of biotechnology A Inserting a functional copy of a gene in a patient to treat a genetic disorder B Injecting stem cells into...
- Q The purpose of the mordant in the Gram stain is to a prevent the crystal violet from leaving the cells b make the flagella visible c make the bacterial cells...
- Q The negative stain could be used to select the best answer a determine flagella arrangement b determine the Gram reaction c visualize endospores d determine cell size el visualize fimbriae
- Q The figure below shows the number of chromosomes observed in an actively dividing cell at each stage of cell division number of chromsomes per cell A B 100 C 90...
- Q Which of the following describes the most likely property of cancer cells other than un controllable division A inability to form spindle fibers B C D inability of chromosomes to...
- Q A cell can normally halt its progression through the cell cycle at different checkpoints Which of the following best predicts a reason for a cell to halt its progression through...
- Q A researcher who is examining a sample of cells of the same types at different stages of cell division isolates a group of cells in the sample that have 1...
- Q Quorum sensing is a form of paracrine communication in which cells can regulate their function in response to changes to which of the following properties A B C D population...
- Q There are four mechanisms that can cause changes in the frequencies of genes in populations mutation migration genetic drift and natural selection All four are mechanisms of evolutionary change Compare...
- Q Which statement best describes natural selection O Random assortment of genes results in better characteristics in the following generations O Only the largest and strongest survive O Some live and...
- Q What is the end result of the cell cycle and mitosis
- Q 21 Which statement is not correct ABC transporters transport amino acids into procariotic cells ABC transporters are located only in the membrane of cancer cells In eukaryotes ABC transporters carry...
- Q SE1 Describe the DNA damage caused by exposure to UV light and how it is repaired
- Q The peptide bond on the C O side of basic residues in a polypeptide is specifically cleaved by A RNase H B succinate dehydrogenase C Factor VIII D Trypsin E...
- Q 1 Roughly one in every 1 000 girls is born with three copies of the X chromosome Although the extra X chromosomes are inactivated in somatic cells triple X females...
- Q diagram below shows a cell during a phase of a type of cell division Use it to answer the following questions LOAA 2 TI yr y T a 3 points...
- Q 20 Meiosis involves the reduction of the a diploid haploid b haploid diploid c diploid diploid d haploid haploid state to the state
- Q 15 In this phase of mitosis sister chromatids are attached to spindle fibers at a kinetoch a metaphase b telophase c prophase d interphase
- Q 9 Which statement is NOT correct a Meiosis produces somatic cells There are two divisions in meiosis Meiosis results in four daughter cells d Both A and B are incorrect...
- Q 8 Which of the following is the correct order of mitosis a Prophase anaphase metaphase telophase cytokinesis b Prophase metaphase anaphase telophase cytokinesis c Metaphase telophase cytokinesis anaphase prophase d...
- Q aminoacyla 8 The substrate atom which undergoes nucleophilic attack in transcriptional elongation is the A a phosphate of the incoming NTP B 5 hydroxyl on the 5 end deoxyribose C...
- Q 2 The substrate atom which undergoes nucleophilic attack in transcriptional elongation is th A 5 hydroxyl on the 5 end deoxyribose B 3 hydroxyl on the 3 end ribose C...
- Q BI In the illustration above a parent cell is going through cell division Black lines represent nucleic acids and blue dots represent kinetochore complexes These nucleic acids are aligned on...
- Q What phase of Meiosis is being shown in the picture below O Prophase I O Anaphase I O Metaphase I O Prophase II Telophase I O Telophase II Anaphase II...
- Q During the cell cycle DNA replication occurs during interphase O True O False
- Q 4 What is nondisjunction 5 What is the role of cyclin in the regulation of the cell cycle 6 Where is the receptor for a ligand that stimulates a response...
- Q Dyneins move vesiclesOa. From the microbubule (+) end to the (-) endO b. From the microtubule (-) end to the (+) endOc Bi-directionally along the same microtubuleO d. Along both...
- Q Cells of a multicellular organism receive and respond to signals from other cells. Which of the following is LEAST likely to be part of a signaling pathway?increasing the rate of...
- Q In the axenomes, the arrangement of 9 outer doublet microtubules, as well as the protofilament number of each outer doublet. is specified bya. Gamma-tubulinb. The centrosomec. The basal bodyd. Nevin
- Q What are 3 ways by which bacteria can overcome, evade or avoid phagocytosis?
- Q Which of the following is a reason that cells reproduce or divide?Cell size is limited, so greater numbers are necessary to complete large, biologically demanding tasks.The volume of a cell...
- Q Explain how the X and Y chromosomes are able to pair together in meiosis as homologous chromosomes. Also, explain what role the SRY region of the Y chromosome plays in...
- Q The microtubules that come from the centrosomes during cell division are calleda. Endoplasmic reticulumb. Spindle fibersc. Golgi bodyd. Ribosomes
- Q Lysogeny/lysogenic life cycle can result in the following EXCEPT:viral DNA/provirus is passed onto the progeny of the lysogenic cell by fissionSpecialized transductionGeneralized transductionphage conversionimmunity to infection by the same type...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!