Biology question and answers for December 19, 2023
- Q A scientist is researching the cell division and differentiation for neurons, or nerve cells. The scientist notices that neurons do not divide when fully matured, even when an injury is...
- Q Using your knowledge of prokaryotic growth and generation times determine how many organisms will be present using the following informing - If you started with 125 organisms and one generation...
- Q Why is meiosis important for sexual reproduction?It allows the zygote formed from fertilization to have half the original number of chromosomes of the organismIt allows gametes to have half the...
- Q Before mitosis begins, which happens before the nucleus starts dividing?The sister chromatids separate.The homologous chromosomes cross over.The DNA replicates.The cytoplasm separates.
- Q When a future mother visits the obstetrician for the first time, she usually has many questions regarding inheritance and the possibility of genetic issues. Explaining how the gametes are formed...
- Q In the growth curve of bacteria in finite (limited) nutrients, the graph shows no change in population size in which of the following phases?laglogstationarydeathtwo of the above
- Q sherry inherited an Rb mutant copy from her mom and a wild type copy from her dad. is she at high risk of getting a tumor? a. yes bc rb...
- Q The final checkpoint of the cell cycle occurs during mid M-phase, just before anaphase. Which of the following conditions would cause a cell to pause at this final checkpoint?The cell...
- Q Which of the following statements is FALSE?Cyclins help determine the target specificity of Cdks.Cyclins activate Cdks by phosphorylating them.Cyclins are expressed at specific times in the cell cycleCyclins have no...
- Q During the formation of the mitotic spindle in early mitosis, the spindle poles separate and move tomake contact with each other and push theopposite sides of the cell. This occurs...
- Q Rb plays an important role in regulating the cell cycle. What is the function of the protein Rb?In the absence of DNA damage. Rb activates transcription and triggers the G?/S...
- Q You make a karyotype from a cell and observe that the cell has 10 chromosomes. However, upon further observation, you are not able to find any homologous pairs. What kind...
- Q Why is it important for each daughter cell to contain information identical to the parent cell?to maintain the proper surface area to volume ratioto generate a haploid cellto control the...
- Q Order the following choices to demonstrate your understanding of the life cycle of an animal virus.Drag the text blocks below into theircorrect order.Adsorption (attachment) to host cell surfaceSynthesis of viral...
- Q During crossing-over,chromatids exchange genetic materialmitosis becomes meiosischromosomes switch poleschromosomes become chromatinchromatin becomes chromosomes
- Q What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?CCTATGCTTGCGGCAACGTGCGGTACTA
- Q Suppose Alia recently learned that she inherited a mutant BRCA1 allele from her mother, who had breast cancer. BRCAI is a tumor suppressor gene that is related to breast cancer....
- Q Somatic cellreproduction resultsin the production ofA. genetically diverse cellsB. similar cellsC. stem cellsD. clones
- Q Crossing over only occurs between ____, otherwise the chemical differences prohibit proper bonding.A homo-logous chromo-somesB analogous chromo-somesC non-sister chromatids
- Q The most commonform of selectivepermeability in a cellmembrane isA. facilitated diffusion.B. simple diffusion.C. channel-mediated diffusion.D. osmosis of lipids.
- Q Once pyruvate is produced in glycolysis, the cell has two choices, without oxygen which option does it NOT have? A. Alcoholic fermentationB. Lactic acid fermentationC. Oxidative phosphorylationD. Anaerobic respiration
- Q Meiotic formation of gametes in sexual reproduction halves the chromosome number and allows a [?] zygote to be formed. diploidhaploidtriploid
- Q Meiosis has a special method of producing haploid gametes, without this the chromosome # would with each division. A. halveB. stay the sameC. increase by a factor of 1.5D. double
- Q Meiosis II finishes with [?], which results in daughter cells.A telophase II B binary fission C prophase II
- Q You are a researcher investigating whether a drug that you have discovered is effective for treating lung cancer. You decide to perform a gene expression microarray analysis. You treated the...
- Q A "belt" of proteins pinches a cleavage furrow into a cell, the process is called. A. prophaseC. telophaseB. metaphaseD. cytokinesis
- Q Which of the following components make up the structure of the apoptosome, which forms during the activation of the intrinsic pathway of apoptosis?Select all that apply.A) Procaspase-3B) Apaf-1C) Bcl-2D) p53E)...
- Q Match the statement in the left with the type of gene in the rightThis is a mutated gene that allows an uncontrolled cellular growthErrors made by DNA polymerase cannot be...
- Q Scientists hypothesize that over millions of years, the Y chromosome has lost genes to the X chromosome during meiosis. Explain how this could happen. During which stage of meiosis would...
- Q The distribution of chromosomes in one type of cell division is shown in the diagram below.Which process and type of resulting cells are represented in the diagram?Meiosis, which produces body...
- Q During the early stages of meiosis, centrioles will position themselves at opposite ends of the cell. Microtubulextend from the centrioles, causing long spindle fibers to reach across the cell and...
- Q The cell cycle includes interphase and mitosis. Interphase is divided into three parts which are______________.GO, G1, and G2Cancerous, pre-cancerous and non-cancerous cell growthnone of the answers are correctG1, S and...
- Q A scientist has noticed that the phospholipid, phosphatidylethanolamine,displays an asymmetric distribution in the cell membrane. Where would youMOST likely predict to find a concentration of phosphatidylethanolamine?In the non-cytosolic face of...
- Q In cancer, cells divide out of control. Thus, chemicals that interfere with cell division might be used to stop cancer cells. How many of the following might stop human cancer...
- Q Match the following statements with "prokaryotes", "eukariotes" or "both"Transcription and translation can happen simultaneouslyTranscription takes place in the cytosolTranslation takes place in the ribosomesDNA replication happens only in the nucleusDuring...
- Q Hibernation and the significant drop in internal body temperature seen during specific times of year or times of environmental stress are both examples oftorpor.non-shivering thermogenesis.evaporative cooling.shivering thermogenesis.acclimatization
- Q The stages of mitosis were originally defined by cellular features observable through a light microscope. The six micrographs below show animal cells (lung cells from a newt) during the five...
- Q Which of the following attach to proteins and become important for their identification and sorting? NONE OF THESE carbohydrates nucleic acids small moleculeslipids
- Q B lymphocytes and T lymphocytes mature in the thymus gland.TrueFalse
- Q What are homologous chromosomes?Two genetically identical chromosomes, one from each parentTwo genetically similar chromosomes, one from each parentThe two halves of replicated chromosomesTwo identical chromosomes from one parent
- Q The cell cycle is a repeating sequence of cellular growth and division during the life ofan organism. Which of the following is not a true statement concerning cell division of...
- Q Which of the following statements comparing meiosis and mitosis is false? A single mitotic division produces four diploid cells and a single meiotic division produces four haploid cells. Mitosis maintains...
- Q If a diploid cell has 2N = 20 chromosomes, then that cell would contain:20 different types of chromosomes10 identical types of chromosomes5 different types of chromosomes10 different types of chromosomes20...
- Q If one type of chromosomes fails to divide properly at anaphase I of meiosis I (but anaphase II occurs occurs correctly), the consequence AFTER the entire meiotic cycle would be...
- Q How many cells are produced by one cell undergoing meiosis?4152
- Q Which of the following is a TRUE statement?During telophase of mitosis, each nucleus has one copy of each chromosome.Chromatids separate during anaphase.Division of the cytoplasm begins during metaphase.A nucleolus appears...
- Q 5. During which stage of mitosis do unpacking of chromosomes and the formation of a new nuclear envelope happen? a. Prometaphase b. Metaphase c. Anaphase d. Telophase 6. Which stage...
- Q 7. During which stage of mitosis do the chromosomes become visible under a light microscope?a. Prophase b. Prometaphase c. Metaphase d. Anaphase8. What structure forms by the fusing of Golgi...
- Q Which ONE gives the portion of a cell's lifetime (cell cycle) when it (a) replicates its DNA and when it (b) distributes its replicated copiesof DNA to daughter cells?A. (a)...
- Q A group of cells was assayed for DNA content immediately following mitosis andcytokinesis. These cells were found to have an average of 8 picograms (8 pg) ofDNA per nucleus. These...
- Q Which of the following is NOT a checkpoint in the cell cycle?A. G1C. MB. G2D. S
- Q Which of the following is the mode of action of penicillin?It causes cells to die through plasmolysisIn inhibits the ability of the cell to make peptide crossbarsIn inhibits the ability...
- Q Cell cycle is controlled by cell cycle check point genes
- Q Name the three phases of interphase and briefly mention what happens in each phase.
- Q The human gene EGFR located on chromosome 7 is a proto-oncogene that codes for a growth factor cell surface receptor. The binding of growth factors to this receptor can lead...
- Q A 2N cell with 12 chromosomes undergoes mitosis and then meiosis. At G1...How many chromosomes are in each cellHow many total chromosomes in all cellsTotal number of cellsTotal number of...
- Q Which of the following occurs in meiosis but not in mitosis?condensation of chromosomesseparation of sister chromatidscrossing over of homologous chromosomesalignment of chromosomes on the metaphase plate
- Q Pumpkin pie spice is high in antioxidants. Why are antioxidants considered to be good for you?O They help neutralize very high or very low pH bloodO They slow the reuptake...
- Q The normal somatic (body) cells of a given sexually reproducing species (species X) contain 30 chromosomes.If an individual got cut and needed to repair its cells, it would use for...
- Q A patient undergoing chemotherapy for cancer develops an infection with cytomegalovirus, conclusively diagnosed by the presence of "owl's eye" viral nuclear inclusions in a liver biopsy. This is an example...
- Q During the "lag phase" of a bacterial growth curve, bacteria are...Dying faster that reproducingReproducing faster than dyingDying and reproducing rates are equal, and the number of cells is highPreparing for...
- Q The parent cell that enters meiosis is diploid, whereas the four daughter cells that result are haploid.Which statement correctly describes how cellular DNA content and ploidy levels change during meiosis...
- Q 1. Are sister chromatids present in all or part of this phase?2. Is the DNA condensed in all or part of this phase?3. Does the cell contain twice as much...
- Q A hospital study that compared brain cancer patients and a similar group without brain cancer found no statistically significant association (a = 5%) between cell phone use and a group...
- Q Major Histocompatibility ComplexMajor histocompatibility complex (MHC) genes encode molecules on the cell surface- Class I MHC are present on the membrane of nucleated animal cellsIdentify "self"- Class II MHC are...
- Q What happens directly after prophase?A. AnaphaseB. InterphaseC. TelophaseD. Metaphase
- Q Poor Gertrude. She never paid any attention to warnings given by her doctors or her parasitologyinstructor. She thought that she could go on a safari to Central Africa and everything...
- Q Which of the following cells is formed by meiosis?A. A bacterial cellB. A heart cellC. A fertilized eggD. A sperm cell
- Q Inheritance and Expression of Traits:Question 3Which of the following processes produces gametes, or eggand sperm cells?Sexual reproduction.Mitosis.Binary fission.Meiosis.
- Q A cell in G1 phase has 6 picograms of DNA. At what point in its cell cycle does it have 10 picograms of DNA?A. neverB. at some point during S...
- Q An organism has a chromosome number of 2n=12. At the end of MITOSIS and cytokinesis, eachcell has__ chromosomes and__ DNA molecules.A. 6; 3B. 6; 12C. 12; 12D. 24:12E. 12; 6
- Q The cell below is beginning mitosis. How many chromosomes will be in each daughter cell at the end of mitosis and cytokinesis?A. 2B. 4C. 1D.16E. 8
- Q Compare the processes of aerobic respiration and photosynthesis by choosing the appropriate choices to complete each of the sentences In aerobic respiration glucose is Select In photosynthesis Select In photosynthesis...
- Q MULTIPLE CHOICE True or false Denitrification returns nitrogen to the atmosphere A B True False
- Q A cell is performing aerobic respiration After glycolysis but before pyruvate processing where is most of the energy that was in the original glucose now found O In the 2...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!