Biology question and answers for November 20, 2023
- Q 1 Starlings sometimes assemble in large flocks that in the evening rise up in whirling flight together for 15 or 20 minutes in what looks like some kind of display...
- Q cells have acquired the ability to live in the presence of the antibiotic ampicillin then what might be interpreted about the other genes on the plasmid that you used in...
- Q Which of the following was NOT considered as evidence when comparing DNA and protein as being the genetic material A shape C biochemical language B polarity D internal bond type
- Q The ligase is involved in ODNA replication ORNA processing O translation O gene regulation O transcription
- Q Alfred Sturtevant expected crossing over to be less likely closer to the as the genes are more restricted A centrosome C chromosome B centriole D centromere
- Q Match the term with its corresponding definition F Genotype D Phenotype Wild type allele Mutant allele Dominant trait Recessive trait H Homozygous C Heterozygous Genetic engineering Genetic transformation A Normal...
- Q DNA replication results in two DNA molecules OA each with two new strands OB each with one new strand and one original strand C one with two new strands and...
- Q 44 Let s start with DNA sequence for the synthesis of protein DNA ATG GGT AAT GTT TTC mRNA Codons tRNA Codons Polypeptide Amino acids USE THE CODONS ON THE...
- Q 40 Next a large ribosomal subunit binds to the small unit to make a functional ribosome The job of the ribosome is to hold the m RNA during translation Trve...
- Q With occasional exceptions most DNA comes from the maternal line A mutated C fraternal B endoplasmic reticulum D mitochondrial
- Q If one strand of a DNA molecule has the sequence of bases 5 ATTGCA3 the other complementary DNA strand would have the sequence 3 TAACGT 5 O3 UAACGU 5 O5...
- Q Which statement best describes DNA polymerase O It catalyzes addition of new nucleotides to the 3 end of a growing DNA strand O It is required to separate the strands...
- Q 4 If a female hemophiliac married a normal male what percentage of the offspring would be expected to have hemophilia
- Q The enzyme involved primarily in polymerzation of new DNA strand core replication enzyme OA DNA polymearse III OB Helicase OC DNA polymerase I OD Primase
- Q Shown below is a diagram of a eukaryotic replication bubble with only the template shown Where in the diagram will you find a leading strand Examine the template DNA very...
- Q Given your knowledge of how DNA is replicated which of the following DNA will be present after 100 generations in the Meselson Stah Experiment 50 N14 N14 hybrids and 50...
- Q If you performed the famous semi conservative replication experiment we learned about in class using the bacterium E coli and observed two bands after two generations as shown what is...
- Q What does it mean to say that DNA replicates semi conservatively Some errors are made during DNA replication but these errors are usually repaired When DNA is replicated each daughter...
- Q 12 Explain how the Hershey Chase experiment used bacteriophages with radioactive sulfur and radioactive phosphorus to demonstrate that DNA and not protein is the carrier of genetic information
- Q GGGUUUCUACAGCGUGGAGAGGGUAUGAUCAAUAAAUACAAAAAAAAAA 1 IF ANY write the nucleotide sequence or sequences that is are not encoded in the DNA 2 IF ANY write the nucleotide sequence or sequences that will be...
- Q Which of the following statements about DNA synthesis at the replication fork of a replicating DNA molecule is FALSE A Nucleotides are added at the 3 ends of all the...
- Q TRUE or FALSE The process of DNA replication DNA DNA involves complementary base pairing A TRUE B FALSE OC I don t know
- Q TRUE or FALSE The process of Protein synthesis RNA protein involves complementary base pairing A TRUE OB FALSE OC I don t know 6
- Q Use the genetic code from the table provided to identify the type of mutation that has occurred in the wild type sequence you translated above Choose among following mutations insertion...
- Q Odigia C3BC General Biology I BIO111 course content LAB ACTIVITY 1 INHERITANCE OF THE CORN TEXTURE GENE The corn used for this experiment F2 was obtained when smooth textured corn...
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
- Unlimited Question Access with detailed Answers
- Zin AI - 3 Million Words
- 10 Dall-E 3 Images
- 20 Plot Generations
- Conversation with Dialogue Memory
- No Ads, Ever!
- Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!