You are planning to use PCR to amplify several regions of a piece of DNA. The...

80.2K

Verified Solution

Question

Biology

You are planning to use PCR to amplify several regions of apiece of DNA. The sequence of your template DNA is provided belowalong with the sequences of all available primers. Determine whereeach of the primers bind and answer the following:
5' AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3'
3' TCCCGGTTTACTCTACTCAGTTTTCGACGGCTATTGGCCTATC 5'
Primer 1: 5-TTGGCC 3
P2: 5-GTCAAA-3
p3: 5-AACCGG-3
p4: 5-CCGGTT-3
P1 can bind to the bottom strand?
P4 can bind to the molecule at only one location
Which primer pair would you use to amplify a double stranded pcrfragment of any size from this template
Which primer has the lowest melting point
Using the two selected primers and added all of the PCRcomponents to a test tube answer the following as the polymerasechain rxn proceeds
The concentration of dNTPs will increase,decrease, stay thesame, as the rxn proceeds
The concentration of Taq DNA polymerase will increase,decrease,stay the same, as the rxn proceeds

Answer & Explanation Solved by verified expert

4.2 Ratings (919 Votes)

5 AGGGCCAAATGAGATGAGTCAAAAGCTGCCGATAACCGGATAG 3 3 CCGGTT 5 primer1 will bind to the above strand 5GTCAAA 3 primer2 will bind to the below strand 3 See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member