You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector...

50.1K

Verified Solution

Question

Biology

image

You are asked to subclone the T7 RNA polymerase in the PGEX 4T 3 vector Which of the following forward primers should you use to PCR amplify your T7 RNA polymerase On the primer sequence the restriction recognition site is underlined and the starting ATG of the T7 RNA polymerase is shown in bold Restriction sites are shown in brackets in the pGEX4T 3 schematic PGEX 4T 3 Thrombin Leu Val Pro Arg Gly Serl Pro Asn Ser Arg Val Asp Ser Ser Gly Arg Ile Val Thr Asp CTG GTT CCG CGT GGA TCC CCG AAT TCC CGG GTC GAC TCG AGC GGC CGC ATC GTG ACT GAC TGA t 4 BamHI EcoRI Sall Smal Xhol Notl Stop codons TAATAGGATCCATGAACACGATTAACATCGCTAAG BamHI TAATAGCGGCCGCTGAATGAACACGATTAACATCGCTAAG Notl TAATAGAATTCATGAACACGATTAACATCGCTAAG EcORI TAATACTCGAGCGATGAACACGATTAACATCGCTAAG Xhol TAATANCOCOCCINTCANCACCATTAACATCOSINAC ISmall

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students