You are amplifying the region below What is the primer sequence that would be used...

90.2K

Verified Solution

Question

Biology

image

You are amplifying the region below What is the primer sequence that would be used to make a copy using the top strand as a template Note pretend primers are only 6 nucleotides long here normally they are 20 nucleotides long also normally you would need a primer to copy the bottom strand template as well but you are not asked for the sequence O 5 AATGAT3 5 GTTACT3 5 CAATGATTCATGGCATTGCATCGAT3 3 GTTACTAAGTACCGTAACGTAGCTA5 O 3 GTTACT5 FAISCAT

Answer & Explanation Solved by verified expert
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students