Write the complimentary DNA sequence of the template strand below: 5â€™-TACGAATGCGCTATGTAAGCT3â€™ What is the complimentary RNA sequence...

70.2K

Verified Solution

Question

Biology

Write the complimentary DNA sequence of the template strandbelow: 5â€™-TACGAATGCGCTATGTAAGCT3â€™
What is the complimentary RNA sequence of the DNA strand aboveand what is the amino acid sequence?
If you have an RNA transcript that is 100 bp, how many codonsdoes it contain?
If you take the template DNA that is shown in question 1 andyou mutate the 6^thnucleotide from A to G how does thatimpact the polypeptide sequence
Is it better to have a mutation that inserts 1 nucleotide or adeletion that deletes 3 nucleotides? Explain your answer

Answer & Explanation Solved by verified expert

4.1 Ratings (512 Votes)

1 The complementary DNA sequence of the template strand above is 3 ATGCTTACGCGATACATTCGA 5 The complementary base pairing in DNA involves binding of GuanineG to CytosineC by three hydrogen bonds and binding of Adenine A to ThymineT by two hydrogen bonds 2 The See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member