60.1K

Verified Solution

Link Copied!

Translation Part 1 Label the diagrams as you read the following passage 3 Met UAC 4 5 5 6 THAI 1 Date 8 11 GGUA B 10 9 AUGCCUAGUCGGUAAAAAAAAA talanez www 3 Translation is the process cells use to build new proteins using messenger RNA instructions The ribosome is a cellular structure that acts as the location for translation There are two types of ribonucleic acids RNA that are important for the translation process transfer RNA and messenger RNA Messenger RNA mRNA contains information from the DNA like a photocopy of one page from a giant book The messenger RNA has a 5 end and a 3 end just like a normal DNA strand The 5 end has a modified Guanine nucleotide that is called the methyl G cap This cap is important for the ribosome to find it and attach to the messenger RNA Remember ribosomes don t have eyes Ribosomes are large molecular structures that find their messenger RNA s by bumping into them and holding onto their methyl G caps The messenger RNA also has a poly A tail on the 3 end This tail prevents the RNA from being degraded too quickly In most cells there are enzymes called ribonucleases that float around in the cytoplasm and destroy any RNA that they come across Ribonucleases are important to destroy foreign RNA often viral RNA that happens to be in the cell The poly A tail on the messenger RNA helps to protect the rest of the messenger RNA from getting destroyed accidentally by the ribonucleases In between the G cap and the poly A tail the messenger RNA has triplets of nucleotides called codons The first codon on the 5 side always has the sequence AUG and is called the start codon The last codon before the poly A tail is called the stop codon and always has the sequences UAA UAG or UGA The codons in between can have any sequence except stops UAA UAG and UGA The start codons and in between codons are together like the recipe for a protein This sequence recipe tells the ribosome which amino acid to add together to build a new protein The stop codon tells the ribosome when to stop making that particular sequence Amino acids are carried to the ribosome by the transfer RNA tRNA the second type of RNA involved in translation The amino acid is attached to the top of the tRNA At the bottom of each tRNA there is a triplet of nucleotides called the anti codon During translation the tRNA with the anti codon that is complementary to the codon carries the amino acid to its correct spot in the amino acid sequence In this picture the anti co don AC will pair up with the start codon AUG and the tRNA will start the amino acid sequence with Met

Answer & Explanation Solved by verified expert

See Answer