The diagram below shows how DNA is sequenced Step 1 5 Step 2 ddCTP ddGTP ddTTP ddATP A T Step 3 STARSA Template strand 5 CGCA 3 Primer 3 GCGT 5 sequence known 5 T CGCA 3 3 AATGTGGGCTATICGGGCGT 5 5 TT CGCA 3 3 ATCTGGGCTATTCGGGCGT 5 Step 5 Step 6 3 Laser Step 4 Electrophoresis 3 A Longest A fragment PATCTGGGCTATICGG Detector G Shortest G fragment 5 3 AATCT GGGCT ATT CGG 5 Step 7 5 TTAGACCCGATAAGCCCGCA 3 babresa sortearE Soitin
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
(Save $1 )
One time Pay
(Save $5 )
Billed Monthly
*First month only
You can see the logs in the Dashboard.
