Retrieve the gene sequence of mitochondrial ATPase subunit 6 from Atlantic hagfish (Myxine glutinosa). Draw a...

80.2K

Verified Solution

Question

Biology

Retrieve the gene sequence of mitochondrial ATPase subunit 6from Atlantic hagfish (Myxine glutinosa). Draw a dotplotagainst the homologous gene from sea lamprey (Petromyzonmarinus), and dogfish.

Answer & Explanation Solved by verified expert
3.7 Ratings (295 Votes)
the gene sequence of mitochondrial ATPase subunit 6 fromAtlantic hagfish Myxine glutinosa is retrieved from theNCBI database Retieve the nucleotide sequence within 51535839nucleotide position of the complete mitochondrial genome ofMyxine glutinosaatgataatatctctatttaataccttcgaaagtccatattttctcggcttccctttaataatttttatcgcaatcctaattagtctaa ctatatttatccccgataacaacttactaattaaaaaccaatcctcaatactagcttcaacattcttaaagaccataactaaagaaattt tcagtcctatcaaaaagtctggtcattcttgggcacttcttcttataaccacattaatatttatcttcttaaataacatcaccggacttc    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students