Questions 9 to 13 are in reference to the DNA sequence shown in Question 8. Here is...

80.2K

Verified Solution

Question

Biology

Questions 9 to 13 are in reference to the DNAsequence shown in Question 8.

Here is Question 8.

Question 8:

The top strand of the following segment of DNA serves as thetemplate strand:

3’ TACACCTTGGCGACGACT 5’

5’ ATGTGGAACCGCTGCTGA 3’

We will refer to this segment of DNA as the original (orunmutated) sequence.

Please answer the following questions:

(a) What is the mRNA sequence?

The mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction.Deductions will be made if a sequence is inputted in the wrongdirection.**

(b) Using the mRNA sequence you determined in part (a)of this question, give the sequence of the protein that would betranslated.

The amino acid sequence for this protein isN-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequencefor a protein, and the C-terminus refers to the end of the primarysequence for a protein.

i.e. input the amino acids in the order that they would betranslated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with ahyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer thisquestion.

Question 10:

The original (unmutated) DNA sequence (shown above in Question8) has been mutated to the following (this represents the templatestrand):

3’ TACGACCTTGGCGACGACT 5’

We will refer to this sequence as mutation#2.

Please note that for simplicity only the template strand forthis mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutatedsegment mutation #2?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction.Deductions will be made if a sequence is inputted in the wrongdirection.**

(b) Using the mRNA sequence you determined in part (a)of this question, give the sequence of the protein that would betranslated.

The amino acid sequence for this protein isN-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequencefor a protein, and the C-terminus refers to the end of the primarysequence for a protein.

i.e. input the amino acids in the order that they would betranslated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with ahyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer thisquestion.

4 points   

QUESTION 11

Questions 9 to 13 are in reference to the DNAsequence shown in Question 8.

Question 11:

The original (unmutated) DNA sequence (shown above in Question8) has been mutated to the following (this represents the templatestrand):

3’ TACACCTTAGCGACGACT 5’.

We will refer to this sequence as mutation#3.

Please note that for simplicity only the template strand forthis mutated segment of DNA is shown.

Answer the following questions:

(a) What is the complete mRNA sequence for the mutatedsegment mutation #3?

The mutated mRNA sequence is  5'  3'.

**Please enter your sequence in the 5' to 3' direction.Deductions will be made if a sequence is inputted in the wrongdirection.**

(b) Using the mRNA sequence you determined in part (a)of this question, give the sequence of the protein that would betranslated.

The amino acid sequence for this protein isN-terminus  C-terminus.

**Please note**

The N-terminus refers to the beginning of the primary sequencefor a protein, and the C-terminus refers to the end of the primarysequence for a protein.

i.e. input the amino acids in the order that they would betranslated.

If a codon encodes for a stop codon, type STOP.

When inputting your sequence, separate each amino acid with ahyphen (e.g. Ser-Tyr-STOP).

You will need to consult the genetic code to answer thisquestion.

4 points   

QUESTION 12

Questions 9 to 13 are in reference to the DNAsequence shown in Question 8.

Question 12:

(1 mark each)

In reference to the original sequence (shown in Question 8),classify each type of mutation present from Questions 9 to 11.Choose the best option for each.

mutation #1

mutation #2

  

mutation #3

A.

base substitution - silent mutation

B.

insertion - frameshift mutation

C.

deletion - frameshift mutation

D.

base substitution - missense mutation

E.

base substitution - nonsense mutation

QUESTION 13

Questions 9 to 13 are in reference to the DNAsequence shown in Question 8.

Question 13:

Most mutations have a neutral effect on the phenotype, functionor survival of an organism because they do not elicit anynoticeable change. Whereas other mutations can have a positiveeffect on an organism leading to new versions of proteins that helpan organism adapt to changes in its environment; while othermutations can have a negative effect on the organism and result ina protein that does not function normally or at all.

Answer the following questions based on the responsesyou gave above in Questions 8 to 12.

(a) Based on the protein sequences that were produced as aresult of mutation #1, mutation #2, or mutation #3, describe theeffect, if any, these mutations would likely have on the functionof the protein within the cell. Support your answer.

(b) If these mutations occurred within a germline cell and not asomatic cell, how would the effects of these mutations differ?

Answer & Explanation Solved by verified expert
3.7 Ratings (654 Votes)
The DNA sequence encoding the above 5 amino acids is included within the sequence below 5AACCGAATTCCATGTTATAGC3 3TTGGCTTAAGGTACAATATCG5 You isolate and sequence the following two different    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students