On the sequence below: 1. Indicate the direction oftranscription 2. Indicate which is the coding strand and which oneis the template for the transcription 3. Write down the mRNA 4.Write down the protein clearly indicating the first codon on themRNA(hint: find the Kozak sequence RCCAUGG to identify the firstcodon) 5. Introduce a nonsense mutation 3'AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACTCCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5'5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGTCGTCGCTTTATATGCC 3'
