On the sequence below: 1. Indicate the direction of transcription 2. Indicate which is the coding...

70.2K

Verified Solution

Question

Biology

On the sequence below: 1. Indicate the direction oftranscription 2. Indicate which is the coding strand and which oneis the template for the transcription 3. Write down the mRNA 4.Write down the protein clearly indicating the first codon on themRNA(hint: find the Kozak sequence RCCAUGG to identify the firstcodon) 5. Introduce a nonsense mutation 3'AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACTCCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG 5'5'TCAGCTGACCGTAGTCTGATGCGACACTGACTATGCGCAAAATAACCTAGCGTGGCGTATGTCCCGGGGCCATGGCAGGTTTTGAGGGCTCATCAGTCTACAGTCGTCGCTTTATATGCC 3'

Answer & Explanation Solved by verified expert

4.5 Ratings (700 Votes)

1 Indicate the direction of transcription The answer is The transcription always occurs from 53 2 The template starnd is The answer is 3AGTCGACTGGCATCAGACTACGCTGTGACTGATACGCGTTTTATTGGATCGCACCGCATACAGGGCCCCGGTACCGTCCAAAACT CCCGAGTAGTCAGATGTCAGCAGCGAAATATACGG See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member