Knockout mice are created by incubating embryonic stem (ES)cells with a DNA construct that contains a portion of the gene witha disrupted exon. The exon is disrupted by inserting a gene forneomycin resistance (neo^r) into the exon. Whenthe DNA construct carrying the disrupted exon is taken up by an EScell, a knockout allele results when the added DNA construct

(a)        replicates as anindependent DNA molecule in the ES cell and is maintained in allcells derived from it.

(b)       undergoes homologousrecombination with the wild type allele of the gene in the EScell.

(c)        inserts randomly in thegenome of the ES cell.

(d)       is processed in the ES cellsuch that the neo^r gene is excised and pastedat random sites in the genome of the ES cell.

Depending on the vector used for gene therapy, the therapeuticgene can integrate into the chromosome or it can stay as anextrachromosomal piece of DNA (episome). Some long-lived cells (forexample, neurons, myocytes, hepatocytes) can have stable long-termexpression of the therapeutic gene without integration of theintroduced gene into the host genome. Which vectors will be mostsuitable for introduction of a gene into long-lived cells, wherethe introduced gene does not integrate into the host genome?

(a) Vectors derived from retroviruses

(b)       Vectors derived fromAdeno-associated viruses (AAVs)

(c)        Vectors derivedfrom plant viruses

(d)       Vectors derived frombacterial viruses

For genome editing of a crop plant by CRISPR-Cas9, you havedesigned a sgRNA (single guide RNA) that contains a sequence thatrecognizes the target sequence in the genome of the plant, and aregion that binds to the Cas9 protein. Given the following targetsequence in the genome, the sequence of the sgRNA that recognizesthe target sequence is ______________________________. Binding ofthe sgRNA-Cas9 complex to the target site will lead to a______________ (single or double)-stranded cut in the DNA. Fill inthe blanks using the following choices.

3’-------------GATCGGATCGATGGAACAGA-------------5’

    5’-------------CTAGCCTAGCTACCTTGTCT-------------3’

(a)        3’ –CUAGCCUAGCUACCUUGUCU – 5’; single

(b)       3’ – CUAGCCUAGCUACCUUGUCU –5’; double

(c)        5’ –CUAGCCUAGCUACCUUGUCU – 3’; single

(d)       5’ –CUAGCCUAGCUACCUUGUCU – 3’; double