. Identify the type of POINT mutation (BASE SUBSTITUTION or frameshift mutation)in the following gene, also...

90.2K

Verified Solution

Question

Biology

. Identify the type of POINT mutation (BASE SUBSTITUTION orframeshift mutation)in the following gene, also identify if itresults in a silent, missense or nonsense mutation.

A. Template strand 3’ GGG TAC CCA ATG AAC CAA ACT AGC 5’

B.Write mRNA sequence

C.Write amino acid sequence

D.Now, Replace the base “C” (7th letter from 3’ end) with the base“A”

E.Write mutated gene 3’

F.Write mRNA sequence:


G.Amino acid sequence:

H.Identify if it is a base substitution or a frameshift mutation?__________________________.

I. What is the effect of this mutation (silent or missense ornonsense) ____________________

Answer & Explanation Solved by verified expert
3.9 Ratings (704 Votes)
A Template strand 3 GGG TAC CCA ATG AAC CAA ACT AGC 5 B mRNA is complementary to the template strand A is complementary to T and U is complementary to A and G is complementary to C and vice versa mRNA sequence is 5CCCAUGGGUUACUUGGUUUGAUCG3 C the amino acid    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students