. Identify the type of POINT mutation (BASE SUBSTITUTION or frameshift mutation)in the following gene, also...

90.2K

Verified Solution

Question

Biology

. Identify the type of POINT mutation (BASE SUBSTITUTION orframeshift mutation)in the following gene, also identify if itresults in a silent, missense or nonsense mutation.

A. Template strand 3â€™ GGG TAC CCA ATG AAC CAA ACT AGC 5â€™

B.Write mRNA sequence

C.Write amino acid sequence

D.Now, Replace the base â€œCâ€ (7th letter from 3â€™ end) with the baseâ€œAâ€

E.Write mutated gene 3â€™
F.Write mRNA sequence:

G.Amino acid sequence:

H.Identify if it is a base substitution or a frameshift mutation?______.

I. What is the effect of this mutation (silent or missense ornonsense)

Answer & Explanation Solved by verified expert

3.9 Ratings (704 Votes)

A Template strand 3 GGG TAC CCA ATG AAC CAA ACT AGC 5 B mRNA is complementary to the template strand A is complementary to T and U is complementary to A and G is complementary to C and vice versa mRNA sequence is 5CCCAUGGGUUACUUGGUUUGAUCG3 C the amino acid See Answer

Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:

Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Flex AI - Your personal assistant for all your inquiries!

Become a Member