Genetic Code: Using the standard genetic code, write a sequence encoding the peptide \"MASTERMIX\" How many different sequences...

80.2K

Verified Solution

Question

Biology

Genetic Code:

Using the standard genetic code, write a sequence encoding thepeptide \"MASTERMIX\"

How many different sequences can encode this peptide?

How many genetic codes have been described? (Hint: search NCBIGenetic Codes)

How, in a general way, do these alternative codes tend to differfrom the standard genetic code?

How is selenocysteine encoded?

Answer & Explanation Solved by verified expert
3.8 Ratings (565 Votes)
Using the Standard Genetic Coe the Peptide MASTERMIX has the mRNA sequence 5AUGGCUUCUACUGAACGUAUGAUUUAA3 The DNA sequence for this peptide is 5ATGGCTTCTACTGAACGTATGATTTAA3 The Amino acid M is coded for by 1 codon A is coded for by 4 codons S is    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students