genes are shown below first letter G UUU UUC UUA UUG CUU CUC CUA CUG...
60.1K
Verified Solution
Link Copied!
Question
Biology
genes are shown below first letter G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG U leucine phenylalanine leucine isoleucine START Normal TACCTCGTGGACTGAGGTCTC valine Mutated TACCTCGTGGACTGAGGTCAC RNA Codon Table second letter methionine An RNA codon chart UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG C serine proline threonine alanine UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AMA AAG GAU GAC GAA GAG A tyrosine STOP histidine glutamine asparagine lysine aspartic acid glutamic acid UGU UGC UGA STOP UGG tryptophan CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG cysteine arginine serine arginine glycine U C A G U A G third letter
Answer & Explanation
Solved by verified expert
Get Answers to Unlimited Questions
Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!
Membership Benefits:
Unlimited Question Access with detailed Answers
Zin AI - 3 Million Words
10 Dall-E 3 Images
20 Plot Generations
Conversation with Dialogue Memory
No Ads, Ever!
Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!