Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decreased pH in mitochondria below...

80.2K

Verified Solution

Question

Biology

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes(inherited at the organismal level, but impacts the single cellfound in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell issupposed to function in a normal environment and is being affectedby the items listed above. This means explaining how all aspects ofthe cell (inside and outside) may be impacted by these problems.The chain reaction of the system inside the cell. Some of them maybe related and some of them might not, ultimately whether you canshow the relationships demonstrates to me your understanding of thecomplexity and system of the cell.

a. Make sure to fully explain all of the items listed in thecellular dysfunction as well as all other related items in thesystem of a cell.

2. Identify and explain any causes that you believe may beassociated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell withthese problems using cell biology and bioscience applications, suchas Gene Therapy, developing new organelles, mitochondrial therapy,etc.

Answer & Explanation Solved by verified expert
4.4 Ratings (710 Votes)
3 The cell here shows that there is decrease in pH in cytosol and mitochondria This shows that the H ions are increased in the cytosol and mitochondria The H ion concentration is not    See Answer
Get Answers to Unlimited Questions

Join us to gain access to millions of questions and expert answers. Enjoy exclusive benefits tailored just for you!

Membership Benefits:
  • Unlimited Question Access with detailed Answers
  • Zin AI - 3 Million Words
  • 10 Dall-E 3 Images
  • 20 Plot Generations
  • Conversation with Dialogue Memory
  • No Ads, Ever!
  • Access to Our Best AI Platform: Zin AI - Your personal assistant for all your inquiries!
Become a Member

Other questions asked by students