Cellular Dysfunction
1. Decreased pH in cytosol below the normal range
2. Decreased pH in mitochondria below the normal range
3. Increase in ATP
4. Increase in Hydrolysis
5. Decreasing levels of Glycogen and Triglycerides
6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes(inherited at the organismal level, but impacts the single cellfound in a tissue)
? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA
? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA
7. Increased activity of mitogen-activated protein kinase(s)
8. Poor Ion transport
Questions: (Just need the answer to #3)
1. Identify and explain how the system of a single cell issupposed to function in a normal environment and is being affectedby the items listed above. This means explaining how all aspects ofthe cell (inside and outside) may be impacted by these problems.The chain reaction of the system inside the cell. Some of them maybe related and some of them might not, ultimately whether you canshow the relationships demonstrates to me your understanding of thecomplexity and system of the cell.
a. Make sure to fully explain all of the items listed in thecellular dysfunction as well as all other related items in thesystem of a cell.
2. Identify and explain any causes that you believe may beassociated with these cellular problems in one cell.
3. Explain how your team might be able to fix the one cell withthese problems using cell biology and bioscience applications, suchas Gene Therapy, developing new organelles, mitochondrial therapy,etc.
